EMAIL THIS PAGE TO A FRIEND

SYN2

synapsin II

Synonyms: SYNII SYNIIa SYNIIb
UniProtKB ID: Q92777, A8MY98
Gene ID:
Human(6854) Summary: This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. This member of the synapsin family encodes a neuron-specific phosphoprotein that selectively binds to small synaptic vesicles in the presynaptic nerve terminal. The TIMP4 gene is located within an intron of this gene and is transcribed in the opposite direction. Mutations in this gene may be associated with abnormal presynaptic function and schizophrenia. Alternative splicing of this gene results in two transcripts. [provided by RefSeq, Jul 2008]
Mouse(20965) synapsin II
Rat(29179) synapsin II
cow(782758) synapsin II
sheep(101107824) synapsin II
fruit fly(36848) Syntrophin-like 2
Horse(100057285) synapsin II
dog(484652) synapsin II
chicken(415963) synapsin II
Thale Cress(834084) cohesion family protein SYN2 (SYN2).
Gene Class: Cytoskeleton
252 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003178 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003178 Rosetta Predictions human pricing
NM_133625 Rosetta Predictions human pricing
NM_001034020 Rosetta Predictions rat pricing
NM_019159 Rosetta Predictions rat pricing
NM_001111015 Rosetta Predictions mouse pricing
NM_013681 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036954 predicted 799
2 SASI_Hs01_00036956 predicted 1213
3 SASI_Hs02_00335202 predicted 1146
4 SASI_Hs01_00036957 predicted 808
5 SASI_Hs01_00036958 predicted 1190
6 SASI_Hs01_00036960 predicted 1196
7 SASI_Hs01_00036961 predicted 1012
8 SASI_Hs02_00335203 predicted 924
9 SASI_Hs01_00036962 predicted 1112
10 SASI_Hs01_00036963 predicted 808
11 SASI_Hs01_00036955 predicted 979
12 SASI_Hs01_00036959 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121901 predicted 799
2 SASI_Hs01_00121903 predicted 1211
3 SASI_Hs02_00363257 predicted 1150
4 SASI_Hs01_00121904 predicted 813
5 SASI_Hs01_00121905 predicted 1191
6 SASI_Hs01_00121907 predicted 1197
7 SASI_Hs01_00121908 predicted 1013
8 SASI_Hs02_00363258 predicted 932
9 SASI_Hs01_00121909 predicted 1121
10 SASI_Hs01_00121910 predicted 807
11 SASI_Hs01_00121902 predicted 975
12 SASI_Hs01_00121906 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049274 predicted 533
2 SASI_Rn01_00049275 predicted 776
3 SASI_Rn02_00203897 predicted 892
4 SASI_Rn02_00203898 predicted 1255
5 SASI_Rn01_00049277 predicted 819
6 SASI_Rn01_00049278 predicted 639
7 SASI_Rn01_00049279 predicted 947
8 SASI_Rn01_00049280 predicted 1057
9 SASI_Rn01_00049281 predicted 1085
10 SASI_Rn01_00049282 predicted 1239
11 SASI_Rn01_00049276 predicted 783
12 SASI_Rn01_00049283 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041854 predicted 536
2 SASI_Rn01_00041855 predicted 773
3 SASI_Rn02_00261939 predicted 893
4 SASI_Rn02_00261940 predicted 1262
5 SASI_Rn01_00041857 predicted 817
6 SASI_Rn01_00041858 predicted 645
7 SASI_Rn01_00041859 predicted 947
8 SASI_Rn01_00041860 predicted 1053
9 SASI_Rn01_00041861 predicted 1081
10 SASI_Rn01_00041862 predicted 1245
11 SASI_Rn01_00041856 predicted 780
12 SASI_Rn01_00041863 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306038 predicted 608
2 SASI_Mm02_00306039 predicted 1309
3 SASI_Mm02_00306040 predicted 1249
4 SASI_Mm02_00306041 predicted 733
5 SASI_Mm02_00306042 predicted 869
6 SASI_Mm02_00306043 predicted 1102
7 SASI_Mm02_00306044 predicted 1227
8 SASI_Mm02_00306045 predicted 674
9 SASI_Mm02_00306046 predicted 824
10 SASI_Mm02_00306047 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322548 predicted 611
2 SASI_Mm01_00114024 predicted 1307
3 SASI_Mm01_00114025 predicted 1244
4 SASI_Mm02_00322549 predicted 742
5 SASI_Mm01_00114028 predicted 866
6 SASI_Mm01_00114029 predicted 1103
7 SASI_Mm01_00114030 predicted 1234
8 SASI_Mm01_00114031 predicted 670
9 SASI_Mm02_00322550 predicted 821
10 SASI_Mm02_00322551 predicted 1165
11 SASI_Mm01_00114026 predicted 1985
12 SASI_Mm01_00114027 predicted 1417
13 SASI_Mm01_00114032 predicted 747
14 SASI_Mm01_00114033 predicted 747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013681
SYN2 MISSION shRNA Bacterial Glycerol Stock
synapsin II
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013681.1-2105s1c1
Sequence:CCGGCCTGCATGACTAGGGTAAATACTCGAGTATTTACCCTAGTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013681.1-1547s1c1
Sequence:CCGGCCCAAGGTTGTTTACAGTATACTCGAGTATACTGTAAACAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013681.1-1485s1c1
Sequence:CCGGGCCACAGAGTGGAACACTTAACTCGAGTTAAGTGTTCCACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013681.1-1404s1c1
Sequence:CCGGTGATCTAGTCATCAGCAAGATCTCGAGATCTTGCTGATGACTAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013681.1-818s1c1
Sequence:CCGGGCATCAACTCTCTGGAGTCTACTCGAGTAGACTCCAGAGAGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013681
SYN2 MISSION shRNA shRNA Plasmid DNA
synapsin II
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013681.1-2105s1c1
Sequence:CCGGCCTGCATGACTAGGGTAAATACTCGAGTATTTACCCTAGTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013681.1-1547s1c1
Sequence:CCGGCCCAAGGTTGTTTACAGTATACTCGAGTATACTGTAAACAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013681.1-1485s1c1
Sequence:CCGGGCCACAGAGTGGAACACTTAACTCGAGTTAAGTGTTCCACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013681.1-1404s1c1
Sequence:CCGGTGATCTAGTCATCAGCAAGATCTCGAGATCTTGCTGATGACTAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013681.1-818s1c1
Sequence:CCGGGCATCAACTCTCTGGAGTCTACTCGAGTAGACTCCAGAGAGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013681
SYN2 MISSION shRNA Lentiviral Transduction Particles
synapsin II
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013681.1-2105s1c1
Sequence:CCGGCCTGCATGACTAGGGTAAATACTCGAGTATTTACCCTAGTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013681.1-1547s1c1
Sequence:CCGGCCCAAGGTTGTTTACAGTATACTCGAGTATACTGTAAACAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013681.1-1485s1c1
Sequence:CCGGGCCACAGAGTGGAACACTTAACTCGAGTTAAGTGTTCCACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013681.1-1404s1c1
Sequence:CCGGTGATCTAGTCATCAGCAAGATCTCGAGATCTTGCTGATGACTAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013681.1-818s1c1
Sequence:CCGGGCATCAACTCTCTGGAGTCTACTCGAGTAGACTCCAGAGAGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003178
VALIDATED
SYN2 MISSION shRNA Bacterial Glycerol Stock
synapsin II
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003178.3-1077s1c1
Sequence:CCGGGCCTTTCATTGACTCCAAGTACTCGAGTACTTGGAGTCAATGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003178.3-2089s1c1
Sequence:CCGGGCTTTCTTTCTGCATGACTATCTCGAGATAGTCATGCAGAAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003178.3-1122s1c1
Sequence:CCGGCAACAACTACAAGGCTTACATCTCGAGATGTAAGCCTTGTAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003178.3-894s1c1
Sequence:CCGGCCCTCTCATTGAACAGACATACTCGAGTATGTCTGTTCAATGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003178.4-1207s21c1
Sequence:CCGGCCATGTCAGACAGGTACAAACCTCGAGGTTTGTACCTGTCTGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003178.4-1784s21c1
Sequence:CCGGGTGCTTGTAATGCTCACTTATCTCGAGATAAGTGAGCATTACAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003178.4-803s21c1
Sequence:CCGGCAACTCACTGGAATCCATATACTCGAGTATATGGATTCCAGTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003178
VALIDATED
SYN2 MISSION shRNA shRNA Plasmid DNA
synapsin II
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003178.3-1077s1c1
Sequence:CCGGGCCTTTCATTGACTCCAAGTACTCGAGTACTTGGAGTCAATGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003178.3-2089s1c1
Sequence:CCGGGCTTTCTTTCTGCATGACTATCTCGAGATAGTCATGCAGAAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003178.3-1122s1c1
Sequence:CCGGCAACAACTACAAGGCTTACATCTCGAGATGTAAGCCTTGTAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003178.3-894s1c1
Sequence:CCGGCCCTCTCATTGAACAGACATACTCGAGTATGTCTGTTCAATGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003178.4-1207s21c1
Sequence:CCGGCCATGTCAGACAGGTACAAACCTCGAGGTTTGTACCTGTCTGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003178.4-1784s21c1
Sequence:CCGGGTGCTTGTAATGCTCACTTATCTCGAGATAAGTGAGCATTACAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003178.4-803s21c1
Sequence:CCGGCAACTCACTGGAATCCATATACTCGAGTATATGGATTCCAGTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003178
VALIDATED
SYN2 MISSION shRNA Lentiviral Transduction Particles
synapsin II
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003178.3-1077s1c1
Sequence:CCGGGCCTTTCATTGACTCCAAGTACTCGAGTACTTGGAGTCAATGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003178.3-2089s1c1
Sequence:CCGGGCTTTCTTTCTGCATGACTATCTCGAGATAGTCATGCAGAAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003178.3-1122s1c1
Sequence:CCGGCAACAACTACAAGGCTTACATCTCGAGATGTAAGCCTTGTAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003178.3-894s1c1
Sequence:CCGGCCCTCTCATTGAACAGACATACTCGAGTATGTCTGTTCAATGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003178.4-1207s21c1
Sequence:CCGGCCATGTCAGACAGGTACAAACCTCGAGGTTTGTACCTGTCTGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003178.4-1784s21c1
Sequence:CCGGGTGCTTGTAATGCTCACTTATCTCGAGATAAGTGAGCATTACAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003178.4-803s21c1
Sequence:CCGGCAACTCACTGGAATCCATATACTCGAGTATATGGATTCCAGTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks