EMAIL THIS PAGE TO A FRIEND

SYN3

synapsin III

UniProtKB ID: O14994, B1B1F9
Gene ID:
Human(8224) Summary: This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. The protein encoded by this gene shares the synapsin family domain model, with domains A, C, and E exhibiting the highest degree of conservation. The protein contains a unique domain J, located between domains C and E. Based on this gene's localization to 22q12.3, a possible schizophrenia susceptibility locus, and the established neurobiological roles of the synapsins, this family member may represent a candidate gene for schizophrenia. The TIMP3 gene is located within an intron of this gene and is transcribed in the opposite direction. Alternative splicing of this gene results in multiple splice variants that encode different isoforms. [provided by RefSeq, Oct 2008]
Mouse(27204) synapsin III
Rat(29130) synapsin III
Thale Cress(825124) sister chromatid cohesion 1 protein 3
dog(481290) synapsin III
Horse(100146694) synapsin III
chicken(100857420) synapsin III
cow(100138309) synapsin III
sheep(101118937) synapsin III
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003490 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013722 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013722 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013722 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079241 MISSION® esiRNA esiRNA human SYN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003490 Rosetta Predictions human pricing
NM_133632 Rosetta Predictions human pricing
NM_133633 Rosetta Predictions human pricing
NM_017109 Rosetta Predictions rat pricing
NM_013722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049225 predicted 1917
2 SASI_Hs01_00049226 predicted 2057
3 SASI_Hs01_00049227 predicted 754
4 SASI_Hs01_00049228 predicted 922
5 SASI_Hs01_00049229 predicted 473
6 SASI_Hs01_00049230 predicted 661
7 SASI_Hs01_00049231 predicted 1903
8 SASI_Hs02_00335769 predicted 654
9 SASI_Hs01_00049233 predicted 900
10 SASI_Hs02_00335770 predicted 1113
11 SASI_Hs01_00049232 predicted 413
12 SASI_Hs01_00049234 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083575 predicted 330
2 SASI_Hs01_00083576 predicted 1828
3 SASI_Hs01_00083577 predicted 760
4 SASI_Hs01_00083578 predicted 318
5 SASI_Hs01_00083579 predicted 937
6 SASI_Hs01_00083580 predicted 485
7 SASI_Hs01_00083581 predicted 501
8 SASI_Hs01_00083582 predicted 662
9 SASI_Hs01_00083583 predicted 1815
10 SASI_Hs01_00083584 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204301 predicted 1626
2 SASI_Hs01_00204303 predicted 750
3 SASI_Hs01_00204304 predicted 931
4 SASI_Hs01_00204305 predicted 475
5 SASI_Hs01_00204306 predicted 666
6 SASI_Hs01_00204307 predicted 1607
7 SASI_Hs02_00363263 predicted 651
8 SASI_Hs01_00204309 predicted 895
9 SASI_Hs02_00363264 predicted 1106
10 SASI_Hs02_00363265 predicted 377
11 SASI_Hs01_00204302 predicted 1767
12 SASI_Hs01_00204308 predicted 415
13 SASI_Hs01_00204310 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261342 predicted 1007
2 SASI_Rn01_00069089 predicted 793
3 SASI_Rn01_00069090 predicted 627
4 SASI_Rn01_00069092 predicted 512
5 SASI_Rn01_00069093 predicted 496
6 SASI_Rn01_00069094 predicted 492
7 SASI_Rn01_00069095 predicted 774
8 SASI_Rn01_00069096 predicted 533
9 SASI_Rn01_00069097 predicted 1020
10 SASI_Rn01_00069098 predicted 876
11 SASI_Rn01_00069091 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140317 predicted 1456
2 SASI_Mm01_00140318 predicted 468
3 SASI_Mm01_00140319 predicted 1055
4 SASI_Mm01_00140320 predicted 767
5 SASI_Mm01_00140321 predicted 1086
6 SASI_Mm01_00140322 predicted 817
7 SASI_Mm02_00322639 predicted 522
8 SASI_Mm01_00140323 predicted 863
9 SASI_Mm01_00140324 predicted 1306
10 SASI_Mm01_00140325 predicted 613
11 SASI_Mm01_00140326 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003490
SYN3 MISSION shRNA Bacterial Glycerol Stock
synapsin III
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003490.3-2328s21c1
Sequence:CCGGAGCAATATAGGAGGCAATAATCTCGAGATTATTGCCTCCTATATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003490.3-461s21c1
Sequence:CCGGATACAGACTGGTCGAAGTATTCTCGAGAATACTTCGACCAGTCTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003490.3-1395s21c1
Sequence:CCGGACAGATTAAATCAGCGAAATCCTCGAGGATTTCGCTGATTTAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003490.2-471s1c1
Sequence:CCGGCGTGAGAAATGGGACCAAAGTCTCGAGACTTTGGTCCCATTTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003490.2-1128s1c1
Sequence:CCGGCGAGGTAATGGACAGCTCAATCTCGAGATTGAGCTGTCCATTACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003490.2-2457s1c1
Sequence:CCGGGCCACTCATACTCAGAGCATTCTCGAGAATGCTCTGAGTATGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003490.2-1881s1c1
Sequence:CCGGGCCTGAGAACATACTTTCTAACTCGAGTTAGAAAGTATGTTCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003490.2-1882s1c1
Sequence:CCGGCCTGAGAACATACTTTCTAAACTCGAGTTTAGAAAGTATGTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003490.2-2458s1c1
Sequence:CCGGCCACTCATACTCAGAGCATTACTCGAGTAATGCTCTGAGTATGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003490
SYN3 MISSION shRNA shRNA Plasmid DNA
synapsin III
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003490.3-2328s21c1
Sequence:CCGGAGCAATATAGGAGGCAATAATCTCGAGATTATTGCCTCCTATATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003490.3-461s21c1
Sequence:CCGGATACAGACTGGTCGAAGTATTCTCGAGAATACTTCGACCAGTCTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003490.3-1395s21c1
Sequence:CCGGACAGATTAAATCAGCGAAATCCTCGAGGATTTCGCTGATTTAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003490.2-471s1c1
Sequence:CCGGCGTGAGAAATGGGACCAAAGTCTCGAGACTTTGGTCCCATTTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003490.2-1128s1c1
Sequence:CCGGCGAGGTAATGGACAGCTCAATCTCGAGATTGAGCTGTCCATTACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003490.2-2457s1c1
Sequence:CCGGGCCACTCATACTCAGAGCATTCTCGAGAATGCTCTGAGTATGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003490.2-1881s1c1
Sequence:CCGGGCCTGAGAACATACTTTCTAACTCGAGTTAGAAAGTATGTTCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003490.2-1882s1c1
Sequence:CCGGCCTGAGAACATACTTTCTAAACTCGAGTTTAGAAAGTATGTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003490.2-2458s1c1
Sequence:CCGGCCACTCATACTCAGAGCATTACTCGAGTAATGCTCTGAGTATGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003490
SYN3 MISSION shRNA Lentiviral Transduction Particles
synapsin III
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003490.3-2328s21c1
Sequence:CCGGAGCAATATAGGAGGCAATAATCTCGAGATTATTGCCTCCTATATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003490.3-461s21c1
Sequence:CCGGATACAGACTGGTCGAAGTATTCTCGAGAATACTTCGACCAGTCTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003490.3-1395s21c1
Sequence:CCGGACAGATTAAATCAGCGAAATCCTCGAGGATTTCGCTGATTTAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003490.2-471s1c1
Sequence:CCGGCGTGAGAAATGGGACCAAAGTCTCGAGACTTTGGTCCCATTTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003490.2-1128s1c1
Sequence:CCGGCGAGGTAATGGACAGCTCAATCTCGAGATTGAGCTGTCCATTACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003490.2-2457s1c1
Sequence:CCGGGCCACTCATACTCAGAGCATTCTCGAGAATGCTCTGAGTATGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003490.2-1881s1c1
Sequence:CCGGGCCTGAGAACATACTTTCTAACTCGAGTTAGAAAGTATGTTCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003490.2-1882s1c1
Sequence:CCGGCCTGAGAACATACTTTCTAAACTCGAGTTTAGAAAGTATGTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003490.2-2458s1c1
Sequence:CCGGCCACTCATACTCAGAGCATTACTCGAGTAATGCTCTGAGTATGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013722
SYN3 MISSION shRNA Bacterial Glycerol Stock
synapsin III
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000093505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013722.1-498s1c1
Sequence:CCGGCCATACAGACTGGTCAAAGTACTCGAGTACTTTGACCAGTCTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013722.1-631s1c1
Sequence:CCGGGTTGTGAGAAATGGCACCAAACTCGAGTTTGGTGCCATTTCTCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013722.1-1269s1c1
Sequence:CCGGCGGCAGAGATTATATCATCGACTCGAGTCGATGATATAATCTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013722.1-1077s1c1
Sequence:CCGGCATACAGAAGATTGGATCCAACTCGAGTTGGATCCAATCTTCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013722
SYN3 MISSION shRNA shRNA Plasmid DNA
synapsin III
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000093505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013722.1-498s1c1
Sequence:CCGGCCATACAGACTGGTCAAAGTACTCGAGTACTTTGACCAGTCTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013722.1-631s1c1
Sequence:CCGGGTTGTGAGAAATGGCACCAAACTCGAGTTTGGTGCCATTTCTCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013722.1-1269s1c1
Sequence:CCGGCGGCAGAGATTATATCATCGACTCGAGTCGATGATATAATCTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013722.1-1077s1c1
Sequence:CCGGCATACAGAAGATTGGATCCAACTCGAGTTGGATCCAATCTTCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013722
SYN3 MISSION shRNA Lentiviral Transduction Particles
synapsin III
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000093505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013722.1-498s1c1
Sequence:CCGGCCATACAGACTGGTCAAAGTACTCGAGTACTTTGACCAGTCTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013722.1-631s1c1
Sequence:CCGGGTTGTGAGAAATGGCACCAAACTCGAGTTTGGTGCCATTTCTCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013722.1-1269s1c1
Sequence:CCGGCGGCAGAGATTATATCATCGACTCGAGTCGATGATATAATCTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013722.1-1077s1c1
Sequence:CCGGCATACAGAAGATTGGATCCAACTCGAGTTGGATCCAATCTTCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks