EMAIL THIS PAGE TO A FRIEND

SYNC

syncoilin, intermediate filament protein

Synonyms: SYNC1 SYNCOILIN
UniProtKB ID: Q9H7C4, B4DNK8, B4DY58, C9IY41
Gene ID:
Human(81493) Summary: This gene encodes a member of the intermediate filament family which contains an N-terminal head domain, followed by a central coiled-coil region and a short C-terminal tail. The protein is highly expressed in skeletal and cardiac muscle. The protein links the dystrophin associated protein complex (DAPC) to desmin filaments in muscle and may have a structural role in striated muscle. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
Mouse(68828) syncoilin
Rat(362606) syncoilin, intermediate filament protein
cow(618122) syncoilin, intermediate filament protein
sheep(101105480) syncoilin, intermediate filament protein
domestic guinea pig(100727678) syncoilin, intermediate filament protein
naked mole-rat(101721006) syncoilin, intermediate filament protein
Zebrafish(100034635) syncoilin, intermediate filament protein
chicken(419664) syncoilin, intermediate filament protein
dog(487303) syncoilin, intermediate filament protein
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030786 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023485 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023485 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023485 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002261 MISSION® esiRNA esiRNA targeting human SYNC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030786 Rosetta Predictions human pricing
NM_001108683 Rosetta Predictions rat pricing
NM_023485 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226182 predicted 1442
2 SASI_Hs01_00226183 predicted 1432
3 SASI_Hs01_00226184 predicted 1283
4 SASI_Hs02_00358331 predicted 723
5 SASI_Hs02_00358332 predicted 909
6 SASI_Hs02_00358333 predicted 846
7 SASI_Hs02_00358334 predicted 742
8 SASI_Hs01_00226189 predicted 1486
9 SASI_Hs02_00358335 predicted 692
10 SASI_Hs01_00226191 predicted 1401
11 SASI_Hs01_00226185 predicted 507
12 SASI_Hs01_00226186 predicted 1095
13 SASI_Hs01_00226187 predicted 518
14 SASI_Hs01_00226188 predicted 350
15 SASI_Hs01_00226190 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108683 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241045 predicted 620
2 SASI_Rn02_00241046 predicted 1782
3 SASI_Rn02_00241047 predicted 1551
4 SASI_Rn02_00241048 predicted 559
5 SASI_Rn02_00241049 predicted 738
6 SASI_Rn02_00241050 predicted 542
7 SASI_Rn02_00241051 predicted 355
8 SASI_Rn02_00241052 predicted 308
9 SASI_Rn02_00241053 predicted 1621
10 SASI_Rn02_00241054 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190759 predicted 834
2 SASI_Mm01_00190760 predicted 446
3 SASI_Mm01_00190761 predicted 270
4 SASI_Mm01_00190762 predicted 1626
5 SASI_Mm01_00190763 predicted 1687
6 SASI_Mm01_00190764 predicted 1576
7 SASI_Mm01_00190766 predicted 419
8 SASI_Mm02_00327144 predicted 787
9 SASI_Mm01_00190767 predicted 1730
10 SASI_Mm01_00190768 predicted 492
11 SASI_Mm01_00190765 predicted 1438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030786
SYNC MISSION shRNA Bacterial Glycerol Stock
syncoilin, intermediate filament protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030786.1-409s1c1
Sequence:CCGGGAACAGCTGGAGGAAATGGAACTCGAGTTCCATTTCCTCCAGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030786.1-412s1c1
Sequence:CCGGCAGCTGGAGGAAATGGAAGAACTCGAGTTCTTCCATTTCCTCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030786.1-283s1c1
Sequence:CCGGGAAATGAAGGAGGCTCTGAGACTCGAGTCTCAGAGCCTCCTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030786.1-634s1c1
Sequence:CCGGGCCAAATCTGTAACCCGGAAACTCGAGTTTCCGGGTTACAGATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030786.1-725s1c1
Sequence:CCGGCCAGAAACTTGGCAAGCAATTCTCGAGAATTGCTTGCCAAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030786.1-472s1c1
Sequence:CCGGCAGAAGAACAAAGAGATGGAACTCGAGTTCCATCTCTTTGTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030786.2-1438s21c1
Sequence:CCGGTGAAGAGCTCTCTACTTATAACTCGAGTTATAAGTAGAGAGCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030786.2-297s21c1
Sequence:CCGGACCTTGATGAGACACTCTATGCTCGAGCATAGAGTGTCTCATCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030786.2-525s21c1
Sequence:CCGGCAGTCACAAGGGCGGAGAAATCTCGAGATTTCTCCGCCCTTGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030786
SYNC MISSION shRNA shRNA Plasmid DNA
syncoilin, intermediate filament protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030786.1-409s1c1
Sequence:CCGGGAACAGCTGGAGGAAATGGAACTCGAGTTCCATTTCCTCCAGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030786.1-412s1c1
Sequence:CCGGCAGCTGGAGGAAATGGAAGAACTCGAGTTCTTCCATTTCCTCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030786.1-283s1c1
Sequence:CCGGGAAATGAAGGAGGCTCTGAGACTCGAGTCTCAGAGCCTCCTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030786.1-634s1c1
Sequence:CCGGGCCAAATCTGTAACCCGGAAACTCGAGTTTCCGGGTTACAGATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030786.1-725s1c1
Sequence:CCGGCCAGAAACTTGGCAAGCAATTCTCGAGAATTGCTTGCCAAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030786.1-472s1c1
Sequence:CCGGCAGAAGAACAAAGAGATGGAACTCGAGTTCCATCTCTTTGTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030786.2-1438s21c1
Sequence:CCGGTGAAGAGCTCTCTACTTATAACTCGAGTTATAAGTAGAGAGCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030786.2-297s21c1
Sequence:CCGGACCTTGATGAGACACTCTATGCTCGAGCATAGAGTGTCTCATCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030786.2-525s21c1
Sequence:CCGGCAGTCACAAGGGCGGAGAAATCTCGAGATTTCTCCGCCCTTGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030786
SYNC MISSION shRNA Lentiviral Transduction Particles
syncoilin, intermediate filament protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030786.1-409s1c1
Sequence:CCGGGAACAGCTGGAGGAAATGGAACTCGAGTTCCATTTCCTCCAGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030786.1-412s1c1
Sequence:CCGGCAGCTGGAGGAAATGGAAGAACTCGAGTTCTTCCATTTCCTCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030786.1-283s1c1
Sequence:CCGGGAAATGAAGGAGGCTCTGAGACTCGAGTCTCAGAGCCTCCTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030786.1-634s1c1
Sequence:CCGGGCCAAATCTGTAACCCGGAAACTCGAGTTTCCGGGTTACAGATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030786.1-725s1c1
Sequence:CCGGCCAGAAACTTGGCAAGCAATTCTCGAGAATTGCTTGCCAAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030786.1-472s1c1
Sequence:CCGGCAGAAGAACAAAGAGATGGAACTCGAGTTCCATCTCTTTGTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030786.2-1438s21c1
Sequence:CCGGTGAAGAGCTCTCTACTTATAACTCGAGTTATAAGTAGAGAGCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030786.2-297s21c1
Sequence:CCGGACCTTGATGAGACACTCTATGCTCGAGCATAGAGTGTCTCATCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030786.2-525s21c1
Sequence:CCGGCAGTCACAAGGGCGGAGAAATCTCGAGATTTCTCCGCCCTTGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023485
SYNC MISSION shRNA Bacterial Glycerol Stock
syncoilin, intermediate filament protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-1374s1c1
Sequence:CCGGGCAAGTTCAGCAACAGAAGAACTCGAGTTCTTCTGTTGCTGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-1242s1c1
Sequence:CCGGGCTCCAACTTAAGAACAGGAACTCGAGTTCCTGTTCTTAAGTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-270s1c1
Sequence:CCGGGACTGTGAACCTAGAGGACATCTCGAGATGTCCTCTAGGTTCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-1434s1c1
Sequence:CCGGGCTTTCCACATATAAGGCTATCTCGAGATAGCCTTATATGTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-1299s1c1
Sequence:CCGGCGATGAAGAGGTTCAACAGTACTCGAGTACTGTTGAACCTCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-193s21c1
Sequence:CCGGTCCTCTTCAGGAGTCAGAATCCTCGAGGATTCTGACTCCTGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-839s21c1
Sequence:CCGGGAATGCGTGGCTTACCAATACCTCGAGGTATTGGTAAGCCACGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-217s21c1
Sequence:CCGGGAAGGAGGCCAAGACCTTTAACTCGAGTTAAAGGTCTTGGCCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-451s21c1
Sequence:CCGGGACGCCAGATGAGGTGCAAATCTCGAGATTTGCACCTCATCTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-345s21c1
Sequence:CCGGAGCCAGCACTGACACTGTTTACTCGAGTAAACAGTGTCAGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023485
SYNC MISSION shRNA shRNA Plasmid DNA
syncoilin, intermediate filament protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-1374s1c1
Sequence:CCGGGCAAGTTCAGCAACAGAAGAACTCGAGTTCTTCTGTTGCTGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-1242s1c1
Sequence:CCGGGCTCCAACTTAAGAACAGGAACTCGAGTTCCTGTTCTTAAGTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-270s1c1
Sequence:CCGGGACTGTGAACCTAGAGGACATCTCGAGATGTCCTCTAGGTTCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-1434s1c1
Sequence:CCGGGCTTTCCACATATAAGGCTATCTCGAGATAGCCTTATATGTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-1299s1c1
Sequence:CCGGCGATGAAGAGGTTCAACAGTACTCGAGTACTGTTGAACCTCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-193s21c1
Sequence:CCGGTCCTCTTCAGGAGTCAGAATCCTCGAGGATTCTGACTCCTGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-839s21c1
Sequence:CCGGGAATGCGTGGCTTACCAATACCTCGAGGTATTGGTAAGCCACGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-217s21c1
Sequence:CCGGGAAGGAGGCCAAGACCTTTAACTCGAGTTAAAGGTCTTGGCCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-451s21c1
Sequence:CCGGGACGCCAGATGAGGTGCAAATCTCGAGATTTGCACCTCATCTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-345s21c1
Sequence:CCGGAGCCAGCACTGACACTGTTTACTCGAGTAAACAGTGTCAGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023485
SYNC MISSION shRNA Lentiviral Transduction Particles
syncoilin, intermediate filament protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-1374s1c1
Sequence:CCGGGCAAGTTCAGCAACAGAAGAACTCGAGTTCTTCTGTTGCTGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-1242s1c1
Sequence:CCGGGCTCCAACTTAAGAACAGGAACTCGAGTTCCTGTTCTTAAGTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-270s1c1
Sequence:CCGGGACTGTGAACCTAGAGGACATCTCGAGATGTCCTCTAGGTTCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-1434s1c1
Sequence:CCGGGCTTTCCACATATAAGGCTATCTCGAGATAGCCTTATATGTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023485.2-1299s1c1
Sequence:CCGGCGATGAAGAGGTTCAACAGTACTCGAGTACTGTTGAACCTCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-193s21c1
Sequence:CCGGTCCTCTTCAGGAGTCAGAATCCTCGAGGATTCTGACTCCTGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-839s21c1
Sequence:CCGGGAATGCGTGGCTTACCAATACCTCGAGGTATTGGTAAGCCACGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-217s21c1
Sequence:CCGGGAAGGAGGCCAAGACCTTTAACTCGAGTTAAAGGTCTTGGCCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-451s21c1
Sequence:CCGGGACGCCAGATGAGGTGCAAATCTCGAGATTTGCACCTCATCTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023485.3-345s21c1
Sequence:CCGGAGCCAGCACTGACACTGTTTACTCGAGTAAACAGTGTCAGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks