EMAIL THIS PAGE TO A FRIEND

SYNCRIP

synaptotagmin binding, cytoplasmic RNA interacting protein

Synonyms: GRY-RBP GRYRBP HNRNPQ HNRPQ1 NSAP1 PP68 hnRNP-Q
Gene ID:
Human(10492) Summary: This gene encodes a member of the cellular heterogeneous nuclear ribonucleoprotein (hnRNP) family. hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA (hnRNA) and regulate alternative splicing, polyadenylation, and other aspects of mRNA metabolism and transport. The encoded protein plays a role in multiple aspects of mRNA maturation and is associated with several multiprotein complexes including the apoB RNA editing-complex and survival of motor neurons (SMN) complex. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 20. [provided by RefSeq, Dec 2011]
Mouse(56403) synaptotagmin binding, cytoplasmic RNA interacting protein
Rat(363113) synaptotagmin binding, cytoplasmic RNA interacting protein
cow(511763) synaptotagmin binding, cytoplasmic RNA interacting protein
sheep(101115037) synaptotagmin binding, cytoplasmic RNA interacting protein
naked mole-rat(101707165) synaptotagmin binding, cytoplasmic RNA interacting protein
Domestic Rabbit(100358009) synaptotagmin binding, cytoplasmic RNA interacting protein
domestic guinea pig(100723388) synaptotagmin binding, cytoplasmic RNA interacting protein
Zebrafish(326663) synaptotagmin binding, cytoplasmic RNA interacting protein
chicken(421831) synaptotagmin binding, cytoplasmic RNA interacting protein
domestic cat(101084196) synaptotagmin binding, cytoplasmic RNA interacting protein
Horse(100070472) synaptotagmin binding, cytoplasmic RNA interacting protein
dog(474986) synaptotagmin binding, cytoplasmic RNA interacting protein
207 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019796 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019796 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019796 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006372 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006372 Rosetta Predictions human pricing
NM_001047916 Rosetta Predictions rat pricing
NM_019666 Rosetta Predictions mouse pricing
NM_019796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247261 predicted 852
2 SASI_Hs01_00247262 predicted 1129
3 SASI_Hs01_00247263 predicted 668
4 SASI_Hs01_00247264 predicted 1124
5 SASI_Hs01_00247265 predicted 1129
6 SASI_Hs01_00247266 predicted 1077
7 SASI_Hs01_00247267 predicted 1595
8 SASI_Hs01_00247268 predicted 2325
9 SASI_Hs01_00247269 predicted 557
10 SASI_Hs01_00247270 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047916 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206772 predicted 380
2 SASI_Rn02_00206773 predicted 1196
3 SASI_Rn02_00206774 predicted 1042
4 SASI_Rn02_00206775 predicted 327
5 SASI_Rn02_00206776 predicted 1324
6 SASI_Rn02_00206777 predicted 1148
7 SASI_Rn02_00206778 predicted 1138
8 SASI_Rn02_00206779 predicted 371
9 SASI_Rn02_00206780 predicted 1201
10 SASI_Rn02_00206781 predicted 1064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324722 predicted 393
2 SASI_Mm02_00324723 predicted 531
3 SASI_Mm02_00324724 predicted 957
4 SASI_Mm01_00034530 predicted 1625
5 SASI_Mm02_00324725 predicted 501
6 SASI_Mm01_00034531 predicted 1645
7 SASI_Mm02_00324726 predicted 910
8 SASI_Mm02_00324727 predicted 748
9 SASI_Mm02_00324728 predicted 747
10 SASI_Mm02_00324729 predicted 1735
11 SASI_Mm01_00034527 predicted 217
12 SASI_Mm01_00034528 predicted 1367
13 SASI_Mm01_00034529 predicted 1286
14 SASI_Mm01_00034532 predicted 235
15 SASI_Mm01_00034533 predicted 1277
16 SASI_Mm01_00034534 predicted 1157
17 SASI_Mm01_00034535 predicted 359
18 SASI_Mm01_00034536 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325022 predicted 390
2 SASI_Mm02_00325023 predicted 525
3 SASI_Mm02_00325024 predicted 957
4 SASI_Mm01_00051412 predicted 1625
5 SASI_Mm02_00325025 predicted 499
6 SASI_Mm01_00051413 predicted 1648
7 SASI_Mm02_00325026 predicted 903
8 SASI_Mm02_00325027 predicted 743
9 SASI_Mm02_00325028 predicted 750
10 SASI_Mm02_00325029 predicted 1733
11 SASI_Mm01_00051409 predicted 385
12 SASI_Mm01_00051410 predicted 1516
13 SASI_Mm01_00051411 predicted 1439
14 SASI_Mm01_00051414 predicted 387
15 SASI_Mm01_00051415 predicted 1421
16 SASI_Mm01_00051416 predicted 1308
17 SASI_Mm01_00051417 predicted 518
18 SASI_Mm01_00051418 predicted 1532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019796
VALIDATED
SYNCRIP MISSION shRNA Bacterial Glycerol Stock
synaptotagmin binding, cytoplasmic RNA interacting protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019796.4-997s21c1
Sequence:CCGGGCAGCACAAGAGGCTGTTAAACTCGAGTTTAACAGCCTCTTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019796.4-1392s21c1
Sequence:CCGGCAACACGGTAACAGAAGAAATCTCGAGATTTCTTCTGTTACCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019796.4-1264s21c1
Sequence:CCGGCGTAGGCTAATGAGTGGTAAACTCGAGTTTACCACTCATTAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019796.4-511s21c1
Sequence:CCGGGCACATAGTGATTTAGATGAACTCGAGTTCATCTAAATCACTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-1858s1c1
Sequence:CCGGGCAACCTTAAATATCTCGGATCTCGAGATCCGAGATATTTAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-260s1c1
Sequence:CCGGGCACATAGTGATTTAGATGAACTCGAGTTCATCTAAATCACTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-1141s1c1
Sequence:CCGGCAACACGGTAACAGAAGAAATCTCGAGATTTCTTCTGTTACCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-746s1c1
Sequence:CCGGGCAGCACAAGAGGCTGTTAAACTCGAGTTTAACAGCCTCTTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-1013s1c1
Sequence:CCGGCGTAGGCTAATGAGTGGTAAACTCGAGTTTACCACTCATTAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019796
VALIDATED
SYNCRIP MISSION shRNA shRNA Plasmid DNA
synaptotagmin binding, cytoplasmic RNA interacting protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019796.4-997s21c1
Sequence:CCGGGCAGCACAAGAGGCTGTTAAACTCGAGTTTAACAGCCTCTTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019796.4-1392s21c1
Sequence:CCGGCAACACGGTAACAGAAGAAATCTCGAGATTTCTTCTGTTACCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019796.4-1264s21c1
Sequence:CCGGCGTAGGCTAATGAGTGGTAAACTCGAGTTTACCACTCATTAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019796.4-511s21c1
Sequence:CCGGGCACATAGTGATTTAGATGAACTCGAGTTCATCTAAATCACTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-1858s1c1
Sequence:CCGGGCAACCTTAAATATCTCGGATCTCGAGATCCGAGATATTTAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-260s1c1
Sequence:CCGGGCACATAGTGATTTAGATGAACTCGAGTTCATCTAAATCACTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-1141s1c1
Sequence:CCGGCAACACGGTAACAGAAGAAATCTCGAGATTTCTTCTGTTACCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-746s1c1
Sequence:CCGGGCAGCACAAGAGGCTGTTAAACTCGAGTTTAACAGCCTCTTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-1013s1c1
Sequence:CCGGCGTAGGCTAATGAGTGGTAAACTCGAGTTTACCACTCATTAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019796
VALIDATED
SYNCRIP MISSION shRNA Lentiviral Transduction Particles
synaptotagmin binding, cytoplasmic RNA interacting protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019796.4-997s21c1
Sequence:CCGGGCAGCACAAGAGGCTGTTAAACTCGAGTTTAACAGCCTCTTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019796.4-1392s21c1
Sequence:CCGGCAACACGGTAACAGAAGAAATCTCGAGATTTCTTCTGTTACCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019796.4-1264s21c1
Sequence:CCGGCGTAGGCTAATGAGTGGTAAACTCGAGTTTACCACTCATTAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019796.4-511s21c1
Sequence:CCGGGCACATAGTGATTTAGATGAACTCGAGTTCATCTAAATCACTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-1858s1c1
Sequence:CCGGGCAACCTTAAATATCTCGGATCTCGAGATCCGAGATATTTAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-260s1c1
Sequence:CCGGGCACATAGTGATTTAGATGAACTCGAGTTCATCTAAATCACTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-1141s1c1
Sequence:CCGGCAACACGGTAACAGAAGAAATCTCGAGATTTCTTCTGTTACCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-746s1c1
Sequence:CCGGGCAGCACAAGAGGCTGTTAAACTCGAGTTTAACAGCCTCTTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019796.2-1013s1c1
Sequence:CCGGCGTAGGCTAATGAGTGGTAAACTCGAGTTTACCACTCATTAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006372
VALIDATED
SYNCRIP MISSION shRNA Bacterial Glycerol Stock
synaptotagmin binding, cytoplasmic RNA interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006372.3-1806s21c1
Sequence:CCGGGTATGACGATTACTACTATTACTCGAGTAATAGTAGTAATCGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006372.3-1086s21c1
Sequence:CCGGTATATGGGATCTTCGTCTAATCTCGAGATTAGACGAAGATCCCATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006372.3-2460s21c1
Sequence:CCGGGAACGGGTGCCGCTATAATTTCTCGAGAAATTATAGCGGCACCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006372.3-854s21c1
Sequence:CCGGCCAAAGTAGCAGATTCTAGTACTCGAGTACTAGAATCTGCTACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006372.3-1316s21c1
Sequence:CCGGGCAAAGTAACAGAGGGTCTTACTCGAGTAAGACCCTCTGTTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006372.3-1894s1c1
Sequence:CCGGCCTCCAGATTATTATGGATATCTCGAGATATCCATAATAATCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006372.3-1435s1c1
Sequence:CCGGCGTAGGTTAATGAGTGGTAAACTCGAGTTTACCACTCATTAACCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006372.3-1316s1c1
Sequence:CCGGGCAAAGTAACAGAGGGTCTTACTCGAGTAAGACCCTCTGTTACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006372.3-1007s1c1
Sequence:CCGGGCACTGAGATATTTGTGGGAACTCGAGTTCCCACAAATATCTCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006372.3-854s1c1
Sequence:CCGGCCAAAGTAGCAGATTCTAGTACTCGAGTACTAGAATCTGCTACTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006372
VALIDATED
SYNCRIP MISSION shRNA shRNA Plasmid DNA
synaptotagmin binding, cytoplasmic RNA interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006372.3-1806s21c1
Sequence:CCGGGTATGACGATTACTACTATTACTCGAGTAATAGTAGTAATCGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006372.3-1086s21c1
Sequence:CCGGTATATGGGATCTTCGTCTAATCTCGAGATTAGACGAAGATCCCATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006372.3-2460s21c1
Sequence:CCGGGAACGGGTGCCGCTATAATTTCTCGAGAAATTATAGCGGCACCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006372.3-854s21c1
Sequence:CCGGCCAAAGTAGCAGATTCTAGTACTCGAGTACTAGAATCTGCTACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006372.3-1316s21c1
Sequence:CCGGGCAAAGTAACAGAGGGTCTTACTCGAGTAAGACCCTCTGTTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006372.3-1894s1c1
Sequence:CCGGCCTCCAGATTATTATGGATATCTCGAGATATCCATAATAATCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006372.3-1435s1c1
Sequence:CCGGCGTAGGTTAATGAGTGGTAAACTCGAGTTTACCACTCATTAACCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006372.3-1316s1c1
Sequence:CCGGGCAAAGTAACAGAGGGTCTTACTCGAGTAAGACCCTCTGTTACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006372.3-1007s1c1
Sequence:CCGGGCACTGAGATATTTGTGGGAACTCGAGTTCCCACAAATATCTCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006372.3-854s1c1
Sequence:CCGGCCAAAGTAGCAGATTCTAGTACTCGAGTACTAGAATCTGCTACTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006372
VALIDATED
SYNCRIP MISSION shRNA Lentiviral Transduction Particles
synaptotagmin binding, cytoplasmic RNA interacting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006372.3-1806s21c1
Sequence:CCGGGTATGACGATTACTACTATTACTCGAGTAATAGTAGTAATCGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006372.3-1086s21c1
Sequence:CCGGTATATGGGATCTTCGTCTAATCTCGAGATTAGACGAAGATCCCATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006372.3-2460s21c1
Sequence:CCGGGAACGGGTGCCGCTATAATTTCTCGAGAAATTATAGCGGCACCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006372.3-854s21c1
Sequence:CCGGCCAAAGTAGCAGATTCTAGTACTCGAGTACTAGAATCTGCTACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006372.3-1316s21c1
Sequence:CCGGGCAAAGTAACAGAGGGTCTTACTCGAGTAAGACCCTCTGTTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006372.3-1894s1c1
Sequence:CCGGCCTCCAGATTATTATGGATATCTCGAGATATCCATAATAATCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006372.3-1435s1c1
Sequence:CCGGCGTAGGTTAATGAGTGGTAAACTCGAGTTTACCACTCATTAACCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006372.3-1316s1c1
Sequence:CCGGGCAAAGTAACAGAGGGTCTTACTCGAGTAAGACCCTCTGTTACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006372.3-1007s1c1
Sequence:CCGGGCACTGAGATATTTGTGGGAACTCGAGTTCCCACAAATATCTCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006372.3-854s1c1
Sequence:CCGGCCAAAGTAGCAGATTCTAGTACTCGAGTACTAGAATCTGCTACTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks