EMAIL THIS PAGE TO A FRIEND

SYNDIG1

synapse differentiation inducing 1

Synonyms: C20orf39 DSPC2 IFITMD5 TMEM90B
UniProtKB ID: Q9H7V2, Q6IA30, Q9H514
Gene ID:
Mouse(433485) synapse differentiation inducing 1
Rat(362235) synapse differentiation inducing 1
chicken(416717) synapse differentiation inducing 1
domestic cat(101088829) synapse differentiation inducing 1
domestic guinea pig(100721273) synapse differentiation inducing 1
naked mole-rat(101720110) synapse differentiation inducing 1
cow(541217) synapse differentiation inducing 1
sheep(101104331) synapse differentiation inducing 1
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024893 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085521 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085521 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085521 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024893 Rosetta Predictions human pricing
NM_001025020 Rosetta Predictions rat pricing
NM_001085521 Rosetta Predictions mouse pricing
XM_485077 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204858 predicted 709
2 SASI_Hs01_00204859 predicted 1529
3 SASI_Hs01_00204860 predicted 1615
4 SASI_Hs01_00204861 predicted 894
5 SASI_Hs02_00357485 predicted 1528
6 SASI_Hs01_00204864 predicted 1328
7 SASI_Hs01_00204866 predicted 687
8 SASI_Hs01_00204867 predicted 1399
9 SASI_Hs02_00357486 predicted 1608
10 SASI_Hs02_00357487 predicted 1796
11 SASI_Hs01_00204862 predicted 1588
12 SASI_Hs01_00204863 predicted 1801
13 SASI_Hs01_00204865 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079917 predicted 329
2 SASI_Rn01_00079918 predicted 1234
3 SASI_Rn01_00079919 predicted 1088
4 SASI_Rn01_00079920 predicted 916
5 SASI_Rn01_00079921 predicted 1076
6 SASI_Rn01_00079922 predicted 948
7 SASI_Rn01_00079923 predicted 849
8 SASI_Rn01_00079924 predicted 498
9 SASI_Rn01_00079925 predicted 521
10 SASI_Rn01_00079926 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300770 predicted 1092
2 SASI_Mm02_00300771 predicted 314
3 SASI_Mm02_00300772 predicted 323
4 SASI_Mm02_00300773 predicted 1098
5 SASI_Mm02_00300774 predicted 525
6 SASI_Mm02_00300775 predicted 849
7 SASI_Mm02_00300776 predicted 523
8 SASI_Mm02_00300777 predicted 1136
9 SASI_Mm02_00300778 predicted 286
10 SASI_Mm02_00300779 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269629 predicted 1057
2 SASI_Mm01_00269630 predicted 276
3 SASI_Mm01_00269631 predicted 294
4 SASI_Mm01_00269632 predicted 1195
5 SASI_Mm01_00269633 predicted 488
6 SASI_Mm01_00269634 predicted 808
7 SASI_Mm01_00269635 predicted 491
8 SASI_Mm01_00269636 predicted 399
9 SASI_Mm01_00269637 predicted 254
10 SASI_Mm01_00269638 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024893
SYNDIG1 MISSION shRNA Bacterial Glycerol Stock
synapse differentiation inducing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024893.1-692s1c1
Sequence:CCGGGCAAGAGGAATGGTTTAATTACTCGAGTAATTAAACCATTCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024893.1-1492s1c1
Sequence:CCGGCAGTACAAATGATTGCCAAATCTCGAGATTTGGCAATCATTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024893.1-1137s1c1
Sequence:CCGGGAGTGAGGACAATTTCCTCATCTCGAGATGAGGAAATTGTCCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024893.1-1626s1c1
Sequence:CCGGCCAAAGGAAAGCTCCAAAGATCTCGAGATCTTTGGAGCTTTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024893.1-688s1c1
Sequence:CCGGGCTGGCAAGAGGAATGGTTTACTCGAGTAAACCATTCCTCTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024893.1-1239s1c1
Sequence:CCGGCTTGTCCCATGAGACCAACAACTCGAGTTGTTGGTCTCATGGGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024893.1-1129s1c1
Sequence:CCGGGACACAGAGAGTGAGGACAATCTCGAGATTGTCCTCACTCTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024893.1-1383s1c1
Sequence:CCGGCTACCTCTCCAAGAACAACCACTCGAGTGGTTGTTCTTGGAGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024893.1-2145s1c1
Sequence:CCGGCTCCCAAGACTCCTCAAGAAACTCGAGTTTCTTGAGGAGTCTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024893
SYNDIG1 MISSION shRNA shRNA Plasmid DNA
synapse differentiation inducing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024893.1-692s1c1
Sequence:CCGGGCAAGAGGAATGGTTTAATTACTCGAGTAATTAAACCATTCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024893.1-1492s1c1
Sequence:CCGGCAGTACAAATGATTGCCAAATCTCGAGATTTGGCAATCATTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024893.1-1137s1c1
Sequence:CCGGGAGTGAGGACAATTTCCTCATCTCGAGATGAGGAAATTGTCCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024893.1-1626s1c1
Sequence:CCGGCCAAAGGAAAGCTCCAAAGATCTCGAGATCTTTGGAGCTTTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024893.1-688s1c1
Sequence:CCGGGCTGGCAAGAGGAATGGTTTACTCGAGTAAACCATTCCTCTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024893.1-1239s1c1
Sequence:CCGGCTTGTCCCATGAGACCAACAACTCGAGTTGTTGGTCTCATGGGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024893.1-1129s1c1
Sequence:CCGGGACACAGAGAGTGAGGACAATCTCGAGATTGTCCTCACTCTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024893.1-1383s1c1
Sequence:CCGGCTACCTCTCCAAGAACAACCACTCGAGTGGTTGTTCTTGGAGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024893.1-2145s1c1
Sequence:CCGGCTCCCAAGACTCCTCAAGAAACTCGAGTTTCTTGAGGAGTCTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024893
SYNDIG1 MISSION shRNA Lentiviral Transduction Particles
synapse differentiation inducing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024893.1-692s1c1
Sequence:CCGGGCAAGAGGAATGGTTTAATTACTCGAGTAATTAAACCATTCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024893.1-1492s1c1
Sequence:CCGGCAGTACAAATGATTGCCAAATCTCGAGATTTGGCAATCATTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024893.1-1137s1c1
Sequence:CCGGGAGTGAGGACAATTTCCTCATCTCGAGATGAGGAAATTGTCCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024893.1-1626s1c1
Sequence:CCGGCCAAAGGAAAGCTCCAAAGATCTCGAGATCTTTGGAGCTTTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024893.1-688s1c1
Sequence:CCGGGCTGGCAAGAGGAATGGTTTACTCGAGTAAACCATTCCTCTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024893.1-1239s1c1
Sequence:CCGGCTTGTCCCATGAGACCAACAACTCGAGTTGTTGGTCTCATGGGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024893.1-1129s1c1
Sequence:CCGGGACACAGAGAGTGAGGACAATCTCGAGATTGTCCTCACTCTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024893.1-1383s1c1
Sequence:CCGGCTACCTCTCCAAGAACAACCACTCGAGTGGTTGTTCTTGGAGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024893.1-2145s1c1
Sequence:CCGGCTCCCAAGACTCCTCAAGAAACTCGAGTTTCTTGAGGAGTCTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085521
SYNDIG1 MISSION shRNA Bacterial Glycerol Stock
synapse differentiation inducing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085521.1-317s21c1
Sequence:CCGGGGCTTAATTAACACCAGAAACCTCGAGGTTTCTGGTGTTAATTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085521.1-1854s21c1
Sequence:CCGGGCCTTACTCTGTCCACTAAATCTCGAGATTTAGTGGACAGAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085521.1-733s21c1
Sequence:CCGGCTACTCCAGCGACACAGAAAGCTCGAGCTTTCTGTGTCGCTGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085521.1-499s21c1
Sequence:CCGGGTCCCACTATCGTCCCAATATCTCGAGATATTGGGACGATAGTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085521.1-935s21c1
Sequence:CCGGGCAGTCCTGTCCATTACTATTCTCGAGAATAGTAATGGACAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085521
SYNDIG1 MISSION shRNA shRNA Plasmid DNA
synapse differentiation inducing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085521.1-317s21c1
Sequence:CCGGGGCTTAATTAACACCAGAAACCTCGAGGTTTCTGGTGTTAATTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085521.1-1854s21c1
Sequence:CCGGGCCTTACTCTGTCCACTAAATCTCGAGATTTAGTGGACAGAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085521.1-733s21c1
Sequence:CCGGCTACTCCAGCGACACAGAAAGCTCGAGCTTTCTGTGTCGCTGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085521.1-499s21c1
Sequence:CCGGGTCCCACTATCGTCCCAATATCTCGAGATATTGGGACGATAGTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085521.1-935s21c1
Sequence:CCGGGCAGTCCTGTCCATTACTATTCTCGAGAATAGTAATGGACAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085521
SYNDIG1 MISSION shRNA Lentiviral Transduction Particles
synapse differentiation inducing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085521.1-317s21c1
Sequence:CCGGGGCTTAATTAACACCAGAAACCTCGAGGTTTCTGGTGTTAATTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085521.1-1854s21c1
Sequence:CCGGGCCTTACTCTGTCCACTAAATCTCGAGATTTAGTGGACAGAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085521.1-733s21c1
Sequence:CCGGCTACTCCAGCGACACAGAAAGCTCGAGCTTTCTGTGTCGCTGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085521.1-499s21c1
Sequence:CCGGGTCCCACTATCGTCCCAATATCTCGAGATATTGGGACGATAGTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085521.1-935s21c1
Sequence:CCGGGCAGTCCTGTCCATTACTATTCTCGAGAATAGTAATGGACAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks