EMAIL THIS PAGE TO A FRIEND

SYNDIG1L

synapse differentiation inducing 1-like

Synonyms: CAPUCIN DSPC1 IFITMD4 TMEM90A
UniProtKB ID: A6NDD5
Gene ID:
Mouse(627191) synapse differentiation inducing 1 like
Rat(685882) synapse differentiation inducing 1-like
cow(617660) synapse differentiation inducing 1-like
sheep(101106851) synapse differentiation inducing 1-like
naked mole-rat(101701178) synapse differentiation inducing 1-like
domestic guinea pig(100733046) synapse differentiation inducing 1-like
Zebrafish(555204) synapse differentiation inducing 1-like
dog(611896) synapse differentiation inducing 1-like
chicken(423351) synapse differentiation inducing 1-like
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033334 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033334 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033334 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001105579 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105579 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105579 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105579 Rosetta Predictions human pricing
XM_929601 Rosetta Predictions human pricing
NM_001109485 Rosetta Predictions rat pricing
NM_001033334 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324591 predicted 576
2 SASI_Hs02_00324592 predicted 1107
3 SASI_Hs02_00324593 predicted 673
4 SASI_Hs02_00324594 predicted 776
5 SASI_Hs02_00324595 predicted 769
6 SASI_Hs02_00324596 predicted 670
7 SASI_Hs02_00324597 predicted 667
8 SASI_Hs02_00324598 predicted 944
9 SASI_Hs02_00324599 predicted 579
10 SASI_Hs02_00324600 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275737 predicted 263
2 SASI_Hs01_00275738 predicted 264
3 SASI_Hs01_00275739 predicted 263
4 SASI_Hs01_00275740 predicted 267
5 SASI_Hs01_00275741 predicted 255
6 SASI_Hs01_00275742 predicted 593
7 SASI_Hs01_00275743 predicted 684
8 SASI_Hs01_00275744 predicted 175
9 SASI_Hs01_00275745 predicted 115
10 SASI_Hs01_00275746 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248859 predicted 1405
2 SASI_Rn02_00248860 predicted 1207
3 SASI_Rn02_00248861 predicted 869
4 SASI_Rn02_00248862 predicted 1258
5 SASI_Rn02_00248863 predicted 1522
6 SASI_Rn02_00248864 predicted 1112
7 SASI_Rn02_00248865 predicted 502
8 SASI_Rn02_00248866 predicted 1387
9 SASI_Rn02_00248867 predicted 787
10 SASI_Rn02_00248868 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167196 predicted 1139
2 SASI_Mm01_00167197 predicted 1387
3 SASI_Mm01_00167200 predicted 619
4 SASI_Mm01_00167201 predicted 756
5 SASI_Mm01_00167202 predicted 1107
6 SASI_Mm01_00167203 predicted 1303
7 SASI_Mm01_00167204 predicted 652
8 SASI_Mm01_00167205 predicted 1202
9 SASI_Mm02_00288585 predicted 1411
10 SASI_Mm02_00288586 predicted 994
11 SASI_Mm01_00167198 predicted 1459
12 SASI_Mm01_00167199 predicted 1044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033334
SYNDIG1L MISSION shRNA Bacterial Glycerol Stock
synapse differentiation inducing 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033334.2-870s21c1
Sequence:CCGGTGGGCATTGCTGCTTTCTATTCTCGAGAATAGAAAGCAGCAATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033334.2-620s21c1
Sequence:CCGGACCGAAGCCAGGGAACCTTTACTCGAGTAAAGGTTCCCTGGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033334.2-1144s21c1
Sequence:CCGGTGAAGAGAACCTGCGACAATACTCGAGTATTGTCGCAGGTTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033334.2-1018s21c1
Sequence:CCGGGGTAGCTCTGGCTGCTTACATCTCGAGATGTAAGCAGCCAGAGCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033334.2-1057s21c1
Sequence:CCGGCTAGTGGTCAGTAGGACTATCCTCGAGGATAGTCCTACTGACCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033334
SYNDIG1L MISSION shRNA shRNA Plasmid DNA
synapse differentiation inducing 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033334.2-870s21c1
Sequence:CCGGTGGGCATTGCTGCTTTCTATTCTCGAGAATAGAAAGCAGCAATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033334.2-620s21c1
Sequence:CCGGACCGAAGCCAGGGAACCTTTACTCGAGTAAAGGTTCCCTGGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033334.2-1144s21c1
Sequence:CCGGTGAAGAGAACCTGCGACAATACTCGAGTATTGTCGCAGGTTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033334.2-1018s21c1
Sequence:CCGGGGTAGCTCTGGCTGCTTACATCTCGAGATGTAAGCAGCCAGAGCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033334.2-1057s21c1
Sequence:CCGGCTAGTGGTCAGTAGGACTATCCTCGAGGATAGTCCTACTGACCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033334
SYNDIG1L MISSION shRNA Lentiviral Transduction Particles
synapse differentiation inducing 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033334.2-870s21c1
Sequence:CCGGTGGGCATTGCTGCTTTCTATTCTCGAGAATAGAAAGCAGCAATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033334.2-620s21c1
Sequence:CCGGACCGAAGCCAGGGAACCTTTACTCGAGTAAAGGTTCCCTGGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033334.2-1144s21c1
Sequence:CCGGTGAAGAGAACCTGCGACAATACTCGAGTATTGTCGCAGGTTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033334.2-1018s21c1
Sequence:CCGGGGTAGCTCTGGCTGCTTACATCTCGAGATGTAAGCAGCCAGAGCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033334.2-1057s21c1
Sequence:CCGGCTAGTGGTCAGTAGGACTATCCTCGAGGATAGTCCTACTGACCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105579
SYNDIG1L MISSION shRNA Bacterial Glycerol Stock
synapse differentiation inducing 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105579.1-674s21c1
Sequence:CCGGCACTTCAACGGAGAGTGAAAGCTCGAGCTTTCACTCTCCGTTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105579.1-586s21c1
Sequence:CCGGAGAATGTCACCATCCAGACTGCTCGAGCAGTCTGGATGGTGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105579.1-2020s21c1
Sequence:CCGGTAAGGGATTTGGTCACATAACCTCGAGGTTATGTGACCAAATCCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105579.1-948s21c1
Sequence:CCGGCAGAACGGTCATGGCTAGTAGCTCGAGCTACTAGCCATGACCGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105579.1-729s21c1
Sequence:CCGGCACCTGGGACTTACTCTCTTCCTCGAGGAAGAGAGTAAGTCCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105579
SYNDIG1L MISSION shRNA shRNA Plasmid DNA
synapse differentiation inducing 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105579.1-674s21c1
Sequence:CCGGCACTTCAACGGAGAGTGAAAGCTCGAGCTTTCACTCTCCGTTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105579.1-586s21c1
Sequence:CCGGAGAATGTCACCATCCAGACTGCTCGAGCAGTCTGGATGGTGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105579.1-2020s21c1
Sequence:CCGGTAAGGGATTTGGTCACATAACCTCGAGGTTATGTGACCAAATCCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105579.1-948s21c1
Sequence:CCGGCAGAACGGTCATGGCTAGTAGCTCGAGCTACTAGCCATGACCGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105579.1-729s21c1
Sequence:CCGGCACCTGGGACTTACTCTCTTCCTCGAGGAAGAGAGTAAGTCCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105579
SYNDIG1L MISSION shRNA Lentiviral Transduction Particles
synapse differentiation inducing 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105579.1-674s21c1
Sequence:CCGGCACTTCAACGGAGAGTGAAAGCTCGAGCTTTCACTCTCCGTTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105579.1-586s21c1
Sequence:CCGGAGAATGTCACCATCCAGACTGCTCGAGCAGTCTGGATGGTGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105579.1-2020s21c1
Sequence:CCGGTAAGGGATTTGGTCACATAACCTCGAGGTTATGTGACCAAATCCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105579.1-948s21c1
Sequence:CCGGCAGAACGGTCATGGCTAGTAGCTCGAGCTACTAGCCATGACCGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105579.1-729s21c1
Sequence:CCGGCACCTGGGACTTACTCTCTTCCTCGAGGAAGAGAGTAAGTCCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks