EMAIL THIS PAGE TO A FRIEND

SYNE1

spectrin repeat containing, nuclear envelope 1

Synonyms: 8B ARCA1 C6orf98 CPG2 EDMD4 MYNE1 Nesp1 SCAR8 dJ45H2.2
Gene ID:
Human(23345) Summary: This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(64009) spectrin repeat containing, nuclear envelope 1
Rat(499010) spectrin repeat containing, nuclear envelope 1
chicken(421640) spectrin repeat containing, nuclear envelope 1
domestic cat(101083516) spectrin repeat containing, nuclear envelope 1
Horse(100062842) spectrin repeat containing, nuclear envelope 1
dog(484037) spectrin repeat containing, nuclear envelope 1
domestic guinea pig(100713551) spectrin repeat containing, nuclear envelope 1
naked mole-rat(101714425) spectrin repeat containing, nuclear envelope 1
Domestic Rabbit(100347993) spectrin repeat containing, nuclear envelope 1
cow(353348) spectrin repeat containing, nuclear envelope 1
sheep(101106269) spectrin repeat containing, nuclear envelope 1
Gene Class: Cytoskeleton
175 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015293 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015293 Rosetta Predictions human pricing
NM_033071 Rosetta Predictions human pricing
NM_133650 Rosetta Predictions human pricing
NM_182961 Rosetta Predictions human pricing
NM_001029909 Rosetta Predictions rat pricing
NM_001079686 Rosetta Predictions mouse pricing
NM_022027 Rosetta Predictions mouse pricing
NM_153399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038793 predicted 9419
2 SASI_Hs01_00038794 predicted 9406
3 SASI_Hs01_00038795 predicted 7590
4 SASI_Hs01_00038796 predicted 10146
5 SASI_Hs01_00038797 predicted 7913
6 SASI_Hs01_00038798 predicted 9008
7 SASI_Hs02_00347484 predicted 8988
8 SASI_Hs01_00038799 predicted 9659
9 SASI_Hs01_00038800 predicted 9829
10 SASI_Hs01_00038801 predicted 10130
11 SASI_Hs01_00038802 predicted 9544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057583 predicted 26016
2 SASI_Hs01_00057584 predicted 26010
3 SASI_Hs01_00057586 predicted 24118
4 SASI_Hs01_00057587 predicted 26754
5 SASI_Hs01_00057588 predicted 24437
6 SASI_Hs01_00057589 predicted 25609
7 SASI_Hs02_00360779 predicted 25588
8 SASI_Hs01_00057590 predicted 26256
9 SASI_Hs01_00057591 predicted 26427
10 SASI_Hs01_00057592 predicted 26729
11 SASI_Hs01_00057585 predicted 26296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115999 predicted 2481
2 SASI_Hs01_00116000 predicted 2473
3 SASI_Hs01_00116001 predicted 571
4 SASI_Hs01_00116002 predicted 3211
5 SASI_Hs01_00116003 predicted 899
6 SASI_Hs01_00116004 predicted 2062
7 SASI_Hs02_00363301 predicted 2046
8 SASI_Hs01_00116005 predicted 2716
9 SASI_Hs01_00116006 predicted 2886
10 SASI_Hs01_00116007 predicted 3189
11 SASI_Hs01_00116008 predicted 2601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153585 predicted 26329
2 SASI_Hs01_00153586 predicted 26317
3 SASI_Hs01_00153588 predicted 24493
4 SASI_Hs01_00153589 predicted 27063
5 SASI_Hs01_00153590 predicted 24823
6 SASI_Hs01_00153591 predicted 25914
7 SASI_Hs02_00371105 predicted 25901
8 SASI_Hs01_00153592 predicted 26570
9 SASI_Hs01_00153593 predicted 26738
10 SASI_Hs01_00153594 predicted 27043
11 SASI_Hs01_00153587 predicted 26600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057400 predicted 6438
2 SASI_Rn01_00057401 predicted 3882
3 SASI_Rn01_00057402 predicted 3572
4 SASI_Rn01_00057403 predicted 16256
5 SASI_Rn01_00057404 predicted 21227
6 SASI_Rn01_00057405 predicted 7771
7 SASI_Rn01_00057406 predicted 15893
8 SASI_Rn01_00057408 predicted 16240
9 SASI_Rn01_00057409 predicted 17474
10 SASI_Rn02_00203474 predicted 22091
11 SASI_Rn01_00057407 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293012 predicted 6832
2 SASI_Mm02_00293013 predicted 8658
3 SASI_Mm02_00293014 predicted 8752
4 SASI_Mm02_00293015 predicted 8663
5 SASI_Mm02_00293016 predicted 7707
6 SASI_Mm02_00293017 predicted 7087
7 SASI_Mm02_00293018 predicted 7129
8 SASI_Mm02_00293019 predicted 7975
9 SASI_Mm02_00293020 predicted 8438
10 SASI_Mm02_00293021 predicted 8948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087287 predicted 790
2 SASI_Mm01_00087288 predicted 2612
3 SASI_Mm01_00087290 predicted 2703
4 SASI_Mm02_00326504 predicted 2618
5 SASI_Mm01_00087291 predicted 1658
6 SASI_Mm01_00087292 predicted 1038
7 SASI_Mm02_00326505 predicted 1085
8 SASI_Mm01_00087293 predicted 1933
9 SASI_Mm01_00087294 predicted 2390
10 SASI_Mm01_00087295 predicted 2902
11 SASI_Mm01_00087289 predicted 1439
12 SASI_Mm01_00087296 predicted 2366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343182 predicted 606
2 SASI_Mm01_00119307 predicted 3438
3 SASI_Mm01_00119308 predicted 2903
4 SASI_Mm01_00119309 predicted 1598
5 SASI_Mm02_00343183 predicted 4084
6 SASI_Mm02_00343184 predicted 4317
7 SASI_Mm01_00119313 predicted 1806
8 SASI_Mm02_00343185 predicted 4107
9 SASI_Mm01_00119315 predicted 1685
10 SASI_Mm01_00119316 predicted 3780
11 SASI_Mm01_00119310 predicted 2852
12 SASI_Mm01_00119311 predicted 2998
13 SASI_Mm01_00119312 predicted 2377
14 SASI_Mm01_00119314 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015293
VALIDATED
SYNE1 MISSION shRNA Bacterial Glycerol Stock
spectrin repeat containing, nuclear envelope 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-7347s21c1
Sequence:CCGGAGCCGTGCAGCAGCTTGATAACTCGAGTTATCAAGCTGCTGCACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-1515s21c1
Sequence:CCGGGCGTTCTTGGGAAACCTTAAACTCGAGTTTAAGGTTTCCCAAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-5014s21c1
Sequence:CCGGGGCCAAACCTGGGCAAATTTACTCGAGTAAATTTGCCCAGGTTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-258s21c1
Sequence:CCGGCAATCAGGCAGCATCACATTTCTCGAGAAATGTGATGCTGCCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-8824s21c1
Sequence:CCGGGGCGAATGCAGTAGCAGTATACTCGAGTATACTGCTACTGCATTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015293.2-10106s21c1
Sequence:CCGGCAGAAGTGCTGGTAGCATAAGCTCGAGCTTATGCTACCAGCACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-4602s21c1
Sequence:CCGGGAACCAGTCCGTGCTACAAATCTCGAGATTTGTAGCACGGACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015293.1-898s1c1
Sequence:CCGGGCTGTGGTACAATATGAACAACTCGAGTTGTTCATATTGTACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015293.1-4647s1c1
Sequence:CCGGGCGTAGTGATAAGACTGATTTCTCGAGAAATCAGTCTTATCACTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015293.1-9021s1c1
Sequence:CCGGGCAGTTTAACTCAGACTTGAACTCGAGTTCAAGTCTGAGTTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015293.1-8295s1c1
Sequence:CCGGGCGTGTGGAAAGATACCATAACTCGAGTTATGGTATCTTTCCACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015293.1-10143s1c1
Sequence:CCGGGCAATCCCAAACTACCAACAACTCGAGTTGTTGGTAGTTTGGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015293
VALIDATED
SYNE1 MISSION shRNA shRNA Plasmid DNA
spectrin repeat containing, nuclear envelope 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-7347s21c1
Sequence:CCGGAGCCGTGCAGCAGCTTGATAACTCGAGTTATCAAGCTGCTGCACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-1515s21c1
Sequence:CCGGGCGTTCTTGGGAAACCTTAAACTCGAGTTTAAGGTTTCCCAAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-5014s21c1
Sequence:CCGGGGCCAAACCTGGGCAAATTTACTCGAGTAAATTTGCCCAGGTTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-258s21c1
Sequence:CCGGCAATCAGGCAGCATCACATTTCTCGAGAAATGTGATGCTGCCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-8824s21c1
Sequence:CCGGGGCGAATGCAGTAGCAGTATACTCGAGTATACTGCTACTGCATTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015293.2-10106s21c1
Sequence:CCGGCAGAAGTGCTGGTAGCATAAGCTCGAGCTTATGCTACCAGCACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-4602s21c1
Sequence:CCGGGAACCAGTCCGTGCTACAAATCTCGAGATTTGTAGCACGGACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015293.1-898s1c1
Sequence:CCGGGCTGTGGTACAATATGAACAACTCGAGTTGTTCATATTGTACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015293.1-4647s1c1
Sequence:CCGGGCGTAGTGATAAGACTGATTTCTCGAGAAATCAGTCTTATCACTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015293.1-9021s1c1
Sequence:CCGGGCAGTTTAACTCAGACTTGAACTCGAGTTCAAGTCTGAGTTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015293.1-8295s1c1
Sequence:CCGGGCGTGTGGAAAGATACCATAACTCGAGTTATGGTATCTTTCCACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015293.1-10143s1c1
Sequence:CCGGGCAATCCCAAACTACCAACAACTCGAGTTGTTGGTAGTTTGGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015293
VALIDATED
SYNE1 MISSION shRNA Lentiviral Transduction Particles
spectrin repeat containing, nuclear envelope 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-7347s21c1
Sequence:CCGGAGCCGTGCAGCAGCTTGATAACTCGAGTTATCAAGCTGCTGCACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-1515s21c1
Sequence:CCGGGCGTTCTTGGGAAACCTTAAACTCGAGTTTAAGGTTTCCCAAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-5014s21c1
Sequence:CCGGGGCCAAACCTGGGCAAATTTACTCGAGTAAATTTGCCCAGGTTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-258s21c1
Sequence:CCGGCAATCAGGCAGCATCACATTTCTCGAGAAATGTGATGCTGCCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-8824s21c1
Sequence:CCGGGGCGAATGCAGTAGCAGTATACTCGAGTATACTGCTACTGCATTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015293.2-10106s21c1
Sequence:CCGGCAGAAGTGCTGGTAGCATAAGCTCGAGCTTATGCTACCAGCACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015293.2-4602s21c1
Sequence:CCGGGAACCAGTCCGTGCTACAAATCTCGAGATTTGTAGCACGGACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015293.1-898s1c1
Sequence:CCGGGCTGTGGTACAATATGAACAACTCGAGTTGTTCATATTGTACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015293.1-4647s1c1
Sequence:CCGGGCGTAGTGATAAGACTGATTTCTCGAGAAATCAGTCTTATCACTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015293.1-9021s1c1
Sequence:CCGGGCAGTTTAACTCAGACTTGAACTCGAGTTCAAGTCTGAGTTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015293.1-8295s1c1
Sequence:CCGGGCGTGTGGAAAGATACCATAACTCGAGTTATGGTATCTTTCCACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015293.1-10143s1c1
Sequence:CCGGGCAATCCCAAACTACCAACAACTCGAGTTGTTGGTAGTTTGGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153399
SYNE1 MISSION shRNA Bacterial Glycerol Stock
spectrin repeat containing, nuclear envelope 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153399.2-1487s21c1
Sequence:CCGGGGAAACAAGTGGAGCATATAACTCGAGTTATATGCTCCACTTGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153399.2-5726s21c1
Sequence:CCGGAGACATAAACAGGGTAATAATCTCGAGATTATTACCCTGTTTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153399.2-704s21c1
Sequence:CCGGACATTGGCACCGCACTCAAATCTCGAGATTTGAGTGCGGTGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153399.2-776s21c1
Sequence:CCGGACATTAATGCTACTGATATTGCTCGAGCAATATCAGTAGCATTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153399.2-748s21c1
Sequence:CCGGTACAGAGGATCACCGATTAAACTCGAGTTTAATCGGTGATCCTCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153399.1-5188s1c1
Sequence:CCGGCCTTCCAGAAATTACCTACAACTCGAGTTGTAGGTAATTTCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153399.1-1585s1c1
Sequence:CCGGCGGCTCTTCGATTGGCATATACTCGAGTATATGCCAATCGAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153399.1-1434s1c1
Sequence:CCGGGCAGGACAAATATCAGGCATTCTCGAGAATGCCTGATATTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153399.1-2389s1c1
Sequence:CCGGGCCGGGAATTTCCTGATTGAACTCGAGTTCAATCAGGAAATTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153399.1-3445s1c1
Sequence:CCGGGCGCCTTATCATTTGCTCCATCTCGAGATGGAGCAAATGATAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153399
SYNE1 MISSION shRNA shRNA Plasmid DNA
spectrin repeat containing, nuclear envelope 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153399.2-1487s21c1
Sequence:CCGGGGAAACAAGTGGAGCATATAACTCGAGTTATATGCTCCACTTGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153399.2-5726s21c1
Sequence:CCGGAGACATAAACAGGGTAATAATCTCGAGATTATTACCCTGTTTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153399.2-704s21c1
Sequence:CCGGACATTGGCACCGCACTCAAATCTCGAGATTTGAGTGCGGTGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153399.2-776s21c1
Sequence:CCGGACATTAATGCTACTGATATTGCTCGAGCAATATCAGTAGCATTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153399.2-748s21c1
Sequence:CCGGTACAGAGGATCACCGATTAAACTCGAGTTTAATCGGTGATCCTCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153399.1-5188s1c1
Sequence:CCGGCCTTCCAGAAATTACCTACAACTCGAGTTGTAGGTAATTTCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153399.1-1585s1c1
Sequence:CCGGCGGCTCTTCGATTGGCATATACTCGAGTATATGCCAATCGAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153399.1-1434s1c1
Sequence:CCGGGCAGGACAAATATCAGGCATTCTCGAGAATGCCTGATATTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153399.1-2389s1c1
Sequence:CCGGGCCGGGAATTTCCTGATTGAACTCGAGTTCAATCAGGAAATTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153399.1-3445s1c1
Sequence:CCGGGCGCCTTATCATTTGCTCCATCTCGAGATGGAGCAAATGATAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153399
SYNE1 MISSION shRNA Lentiviral Transduction Particles
spectrin repeat containing, nuclear envelope 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153399.2-1487s21c1
Sequence:CCGGGGAAACAAGTGGAGCATATAACTCGAGTTATATGCTCCACTTGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153399.2-5726s21c1
Sequence:CCGGAGACATAAACAGGGTAATAATCTCGAGATTATTACCCTGTTTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153399.2-704s21c1
Sequence:CCGGACATTGGCACCGCACTCAAATCTCGAGATTTGAGTGCGGTGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153399.2-776s21c1
Sequence:CCGGACATTAATGCTACTGATATTGCTCGAGCAATATCAGTAGCATTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153399.2-748s21c1
Sequence:CCGGTACAGAGGATCACCGATTAAACTCGAGTTTAATCGGTGATCCTCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153399.1-5188s1c1
Sequence:CCGGCCTTCCAGAAATTACCTACAACTCGAGTTGTAGGTAATTTCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153399.1-1585s1c1
Sequence:CCGGCGGCTCTTCGATTGGCATATACTCGAGTATATGCCAATCGAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153399.1-1434s1c1
Sequence:CCGGGCAGGACAAATATCAGGCATTCTCGAGAATGCCTGATATTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153399.1-2389s1c1
Sequence:CCGGGCCGGGAATTTCCTGATTGAACTCGAGTTCAATCAGGAAATTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153399.1-3445s1c1
Sequence:CCGGGCGCCTTATCATTTGCTCCATCTCGAGATGGAGCAAATGATAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks