EMAIL THIS PAGE TO A FRIEND

SYNE2

spectrin repeat containing, nuclear envelope 2

Synonyms: EDMD5 NUA NUANCE Nesp2 Nesprin-2 SYNE-2 TROPH
Gene ID:
Human(23224) Summary: The protein encoded by this gene is a nuclear outer membrane protein that binds cytoplasmic F-actin. This binding tethers the nucleus to the cytoskeleton and aids in the maintenance of the structural integrity of the nucleus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(319565) spectrin repeat containing, nuclear envelope 2
Rat(366669) spectrin repeat containing, nuclear envelope 2
chicken(423509) spectrin repeat containing, nuclear envelope 2
domestic cat(101086066) spectrin repeat containing, nuclear envelope 2
Horse(100061983) spectrin repeat containing, nuclear envelope 2
dog(490729) spectrin repeat containing, nuclear envelope 2
cow(540504) spectrin repeat containing, nuclear envelope 2
sheep(101108755) spectrin repeat containing, nuclear envelope 2
Domestic Rabbit(100346489) spectrin repeat containing, nuclear envelope 2
naked mole-rat(101727057) spectrin repeat containing, nuclear envelope 2
domestic guinea pig(100716463) spectrin repeat containing, nuclear envelope 2
Gene Class: Cytoskeleton
197 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015180 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099001 MISSION® esiRNA esiRNA human SYNE2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015180 Rosetta Predictions human pricing
NM_182910 Rosetta Predictions human pricing
NM_182912 Rosetta Predictions human pricing
NM_182913 Rosetta Predictions human pricing
NM_182914 Rosetta Predictions human pricing
XM_001080795 Rosetta Predictions rat pricing
XM_345689 Rosetta Predictions rat pricing
NM_001005510 Rosetta Predictions mouse pricing
XM_917083 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191965 predicted 21303
2 SASI_Hs01_00191966 predicted 21264
3 SASI_Hs01_00191967 predicted 19845
4 SASI_Hs01_00191968 predicted 20997
5 SASI_Hs01_00191969 predicted 19892
6 SASI_Hs01_00191970 predicted 21270
7 SASI_Hs01_00191971 predicted 19940
8 SASI_Hs02_00347216 predicted 21310
9 SASI_Hs01_00191972 predicted 19817
10 SASI_Hs01_00191973 predicted 19960
11 SASI_Hs01_00191964 predicted 21155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162407 predicted 2076
2 SASI_Hs01_00162408 predicted 2039
3 SASI_Hs01_00162409 predicted 577
4 SASI_Hs01_00162410 predicted 1769
5 SASI_Hs01_00162411 predicted 620
6 SASI_Hs01_00162412 predicted 2034
7 SASI_Hs01_00162413 predicted 670
8 SASI_Hs02_00371018 predicted 2078
9 SASI_Hs01_00162414 predicted 548
10 SASI_Hs01_00162415 predicted 694
11 SASI_Hs01_00162406 predicted 2476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059168 predicted 2781
2 SASI_Hs01_00059169 predicted 2917
3 SASI_Hs01_00059170 predicted 2874
4 SASI_Hs01_00059171 predicted 1457
5 SASI_Hs01_00059172 predicted 2610
6 SASI_Hs01_00059173 predicted 1492
7 SASI_Hs01_00059174 predicted 2873
8 SASI_Hs01_00059175 predicted 1549
9 SASI_Hs01_00059176 predicted 1432
10 SASI_Hs01_00059177 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178268 predicted 2181
2 SASI_Hs01_00178269 predicted 2147
3 SASI_Hs01_00178270 predicted 675
4 SASI_Hs01_00178271 predicted 1873
5 SASI_Hs01_00178272 predicted 719
6 SASI_Hs01_00178273 predicted 2145
7 SASI_Hs01_00178274 predicted 773
8 SASI_Hs02_00371022 predicted 2187
9 SASI_Hs01_00178275 predicted 655
10 SASI_Hs01_00178276 predicted 794
11 SASI_Hs01_00178267 predicted 2057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166395 predicted 21374
2 SASI_Hs01_00166396 predicted 21327
3 SASI_Hs01_00166397 predicted 19917
4 SASI_Hs01_00166398 predicted 21057
5 SASI_Hs01_00166399 predicted 19955
6 SASI_Hs01_00166400 predicted 21331
7 SASI_Hs01_00166401 predicted 20000
8 SASI_Hs02_00371023 predicted 21378
9 SASI_Hs01_00166402 predicted 19893
10 SASI_Hs01_00166403 predicted 20032
11 SASI_Hs01_00166394 predicted 10479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080795 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369402 predicted 6402
2 SASI_Rn02_00369403 predicted 13674
3 SASI_Rn02_00369404 predicted 5186
4 SASI_Rn02_00369405 predicted 10931
5 SASI_Rn02_00369406 predicted 1833
6 SASI_Rn02_00369407 predicted 6935
7 SASI_Rn02_00369408 predicted 6302
8 SASI_Rn02_00369409 predicted 20053
9 SASI_Rn02_00369410 predicted 8716
10 SASI_Rn02_00369411 predicted 4146
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398609 predicted 397
2 SASI_Rn02_00398610 predicted 500
3 SASI_Rn02_00398611 predicted 727
4 SASI_Rn02_00398612 predicted 335
5 SASI_Rn02_00398613 predicted 424
6 SASI_Rn02_00398614 predicted 823
7 SASI_Rn02_00398615 predicted 488
8 SASI_Rn02_00398616 predicted 857
9 SASI_Rn02_00398617 predicted 872
10 SASI_Rn02_00398618 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286612 predicted 15549
2 SASI_Mm02_00286613 predicted 2214
3 SASI_Mm02_00286614 predicted 11071
4 SASI_Mm02_00286615 predicted 7168
5 SASI_Mm02_00286616 predicted 17872
6 SASI_Mm02_00286617 predicted 9678
7 SASI_Mm02_00286618 predicted 8568
8 SASI_Mm02_00286619 predicted 17907
9 SASI_Mm02_00286620 predicted 15421
10 SASI_Mm02_00286621 predicted 1877
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226459 predicted 15416
2 SASI_Mm01_00226460 predicted 17761
3 SASI_Mm01_00226461 predicted 17351
4 SASI_Mm01_00226462 predicted 19114
5 SASI_Mm01_00226463 predicted 17736
6 SASI_Mm01_00226464 predicted 18186
7 SASI_Mm01_00226465 predicted 16194
8 SASI_Mm01_00226466 predicted 19499
9 SASI_Mm01_00226467 predicted 17777
10 SASI_Mm01_00226468 predicted 15284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015180
SYNE2 MISSION shRNA Bacterial Glycerol Stock
spectrin repeat containing, nuclear envelope 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-5335s1c1
Sequence:CCGGGCAGTGAAATACCTCTTGAATCTCGAGATTCAAGAGGTATTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-798s1c1
Sequence:CCGGGCCACCTATGAGTCTGTCAATCTCGAGATTGACAGACTCATAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-15608s1c1
Sequence:CCGGGCGCTATGAAAGAACGGAGTTCTCGAGAACTCCGTTCTTTCATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-18040s1c1
Sequence:CCGGCGGACATTAGTATTGAAGAAACTCGAGTTTCTTCAATACTAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-364s1c1
Sequence:CCGGCCTCAGTTATATCCGACCTATCTCGAGATAGGTCGGATATAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015180.4-15629s21c1
Sequence:CCGGGCGCTATGAAAGAACGGAGTTCTCGAGAACTCCGTTCTTTCATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015180.4-382s21c1
Sequence:CCGGCCTCAGTTATATCCGACCTATCTCGAGATAGGTCGGATATAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015180.4-281s21c1
Sequence:CCGGCATCGACGATCTCCATATTTCCTCGAGGAAATATGGAGATCGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015180.4-10662s21c1
Sequence:CCGGATTGAACGAGAGGCAATTATTCTCGAGAATAATTGCCTCTCGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015180.4-21322s21c1
Sequence:CCGGGATGGAAACAATCAATCATATCTCGAGATATGATTGATTGTTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015180
SYNE2 MISSION shRNA shRNA Plasmid DNA
spectrin repeat containing, nuclear envelope 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-5335s1c1
Sequence:CCGGGCAGTGAAATACCTCTTGAATCTCGAGATTCAAGAGGTATTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-798s1c1
Sequence:CCGGGCCACCTATGAGTCTGTCAATCTCGAGATTGACAGACTCATAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-15608s1c1
Sequence:CCGGGCGCTATGAAAGAACGGAGTTCTCGAGAACTCCGTTCTTTCATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-18040s1c1
Sequence:CCGGCGGACATTAGTATTGAAGAAACTCGAGTTTCTTCAATACTAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-364s1c1
Sequence:CCGGCCTCAGTTATATCCGACCTATCTCGAGATAGGTCGGATATAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015180.4-15629s21c1
Sequence:CCGGGCGCTATGAAAGAACGGAGTTCTCGAGAACTCCGTTCTTTCATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015180.4-382s21c1
Sequence:CCGGCCTCAGTTATATCCGACCTATCTCGAGATAGGTCGGATATAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015180.4-281s21c1
Sequence:CCGGCATCGACGATCTCCATATTTCCTCGAGGAAATATGGAGATCGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015180.4-10662s21c1
Sequence:CCGGATTGAACGAGAGGCAATTATTCTCGAGAATAATTGCCTCTCGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015180.4-21322s21c1
Sequence:CCGGGATGGAAACAATCAATCATATCTCGAGATATGATTGATTGTTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015180
SYNE2 MISSION shRNA Lentiviral Transduction Particles
spectrin repeat containing, nuclear envelope 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-5335s1c1
Sequence:CCGGGCAGTGAAATACCTCTTGAATCTCGAGATTCAAGAGGTATTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-798s1c1
Sequence:CCGGGCCACCTATGAGTCTGTCAATCTCGAGATTGACAGACTCATAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-15608s1c1
Sequence:CCGGGCGCTATGAAAGAACGGAGTTCTCGAGAACTCCGTTCTTTCATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-18040s1c1
Sequence:CCGGCGGACATTAGTATTGAAGAAACTCGAGTTTCTTCAATACTAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015180.3-364s1c1
Sequence:CCGGCCTCAGTTATATCCGACCTATCTCGAGATAGGTCGGATATAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015180.4-15629s21c1
Sequence:CCGGGCGCTATGAAAGAACGGAGTTCTCGAGAACTCCGTTCTTTCATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015180.4-382s21c1
Sequence:CCGGCCTCAGTTATATCCGACCTATCTCGAGATAGGTCGGATATAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015180.4-281s21c1
Sequence:CCGGCATCGACGATCTCCATATTTCCTCGAGGAAATATGGAGATCGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015180.4-10662s21c1
Sequence:CCGGATTGAACGAGAGGCAATTATTCTCGAGAATAATTGCCTCTCGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015180.4-21322s21c1
Sequence:CCGGGATGGAAACAATCAATCATATCTCGAGATATGATTGATTGTTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005510
SYNE2 MISSION shRNA Bacterial Glycerol Stock
spectrin repeat containing, nuclear envelope 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005510.2-5635s21c1
Sequence:CCGGCAAGTGTCAGCAATCTATTTACTCGAGTAAATAGATTGCTGACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005510.2-8573s21c1
Sequence:CCGGATGTGAGGGTGACGGTTTAAACTCGAGTTTAAACCGTCACCCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005510.2-13730s21c1
Sequence:CCGGTATGACGGAAGAGACGTATATCTCGAGATATACGTCTCTTCCGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005510.2-21409s21c1
Sequence:CCGGATTGCATGGATGTCGTTATTTCTCGAGAAATAACGACATCCATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005510.2-9533s21c1
Sequence:CCGGGAGCGAGATGCAGCGACTAAACTCGAGTTTAGTCGCTGCATCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005510
SYNE2 MISSION shRNA shRNA Plasmid DNA
spectrin repeat containing, nuclear envelope 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005510.2-5635s21c1
Sequence:CCGGCAAGTGTCAGCAATCTATTTACTCGAGTAAATAGATTGCTGACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005510.2-8573s21c1
Sequence:CCGGATGTGAGGGTGACGGTTTAAACTCGAGTTTAAACCGTCACCCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005510.2-13730s21c1
Sequence:CCGGTATGACGGAAGAGACGTATATCTCGAGATATACGTCTCTTCCGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005510.2-21409s21c1
Sequence:CCGGATTGCATGGATGTCGTTATTTCTCGAGAAATAACGACATCCATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005510.2-9533s21c1
Sequence:CCGGGAGCGAGATGCAGCGACTAAACTCGAGTTTAGTCGCTGCATCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005510
SYNE2 MISSION shRNA Lentiviral Transduction Particles
spectrin repeat containing, nuclear envelope 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005510.2-5635s21c1
Sequence:CCGGCAAGTGTCAGCAATCTATTTACTCGAGTAAATAGATTGCTGACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005510.2-8573s21c1
Sequence:CCGGATGTGAGGGTGACGGTTTAAACTCGAGTTTAAACCGTCACCCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005510.2-13730s21c1
Sequence:CCGGTATGACGGAAGAGACGTATATCTCGAGATATACGTCTCTTCCGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005510.2-21409s21c1
Sequence:CCGGATTGCATGGATGTCGTTATTTCTCGAGAAATAACGACATCCATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005510.2-9533s21c1
Sequence:CCGGGAGCGAGATGCAGCGACTAAACTCGAGTTTAGTCGCTGCATCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks