EMAIL THIS PAGE TO A FRIEND

SYNE3

spectrin repeat containing, nuclear envelope family member 3

Synonyms: C14orf49 NET53 Nesp3
UniProtKB ID: Q6ZMZ3, A6H8H3, Q86SX5, Q8N7G8
Gene ID:
Mouse(212073) spectrin repeat containing, nuclear envelope family member 3
Rat(299356) spectrin repeat containing, nuclear envelope family member 3
Zebrafish(100009645) spectrin repeat containing, nuclear envelope family member 3
domestic cat(101082163) spectrin repeat containing, nuclear envelope family member 3
dog(490843) spectrin repeat containing, nuclear envelope family member 3
domestic guinea pig(100725886) spectrin repeat containing, nuclear envelope family member 3
naked mole-rat(101722356) spectrin repeat containing, nuclear envelope family member 3
sheep(101120276) spectrin repeat containing, nuclear envelope family member 3
Gene Class: Cytoskeleton
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152592 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152592 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152592 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152592 Rosetta Predictions human pricing
NM_001106762 Rosetta Predictions rat pricing
XM_234584 Rosetta Predictions rat pricing
NM_001042699 Rosetta Predictions mouse pricing
NM_172500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155419 predicted 2387
2 SASI_Hs01_00155421 predicted 301
3 SASI_Hs01_00155422 predicted 1996
4 SASI_Hs01_00155423 predicted 2372
5 SASI_Hs01_00155424 predicted 2410
6 SASI_Hs02_00366432 predicted 1237
7 SASI_Hs01_00155425 predicted 1701
8 SASI_Hs01_00155426 predicted 1241
9 SASI_Hs01_00155427 predicted 2491
10 SASI_Hs01_00155428 predicted 635
11 SASI_Hs01_00155420 predicted 2336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222148 predicted 1423
2 SASI_Rn02_00222149 predicted 2619
3 SASI_Rn02_00222150 predicted 1588
4 SASI_Rn02_00222151 predicted 1435
5 SASI_Rn02_00222152 predicted 2796
6 SASI_Rn02_00222153 predicted 1498
7 SASI_Rn02_00222154 predicted 2715
8 SASI_Rn02_00222155 predicted 1609
9 SASI_Rn02_00222156 predicted 2096
10 SASI_Rn02_00222157 predicted 3174
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00130332 predicted 356
2 SASI_Rn01_00130333 predicted 224
3 SASI_Rn01_00130334 predicted 356
4 SASI_Rn01_00130335 predicted 668
5 SASI_Rn01_00130336 predicted 554
6 SASI_Rn01_00130337 predicted 441
7 SASI_Rn01_00130338 predicted 317
8 SASI_Rn01_00130339 predicted 481
9 SASI_Rn01_00130340 predicted 229
10 SASI_Rn01_00130341 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290955 predicted 1533
2 SASI_Mm02_00290956 predicted 2225
3 SASI_Mm02_00290957 predicted 3047
4 SASI_Mm02_00290958 predicted 1051
5 SASI_Mm02_00290959 predicted 2748
6 SASI_Mm02_00290960 predicted 2288
7 SASI_Mm02_00290961 predicted 1057
8 SASI_Mm02_00290962 predicted 1471
9 SASI_Mm02_00290963 predicted 2929
10 SASI_Mm02_00290964 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183255 predicted 1183
2 SASI_Mm01_00183257 predicted 1870
3 SASI_Mm01_00183258 predicted 2697
4 SASI_Mm01_00183259 predicted 697
5 SASI_Mm01_00183260 predicted 2397
6 SASI_Mm01_00183261 predicted 1933
7 SASI_Mm02_00344086 predicted 713
8 SASI_Mm01_00183262 predicted 1110
9 SASI_Mm01_00183263 predicted 2581
10 SASI_Mm01_00183264 predicted 526
11 SASI_Mm01_00183256 predicted 283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172500
SYNE3 MISSION shRNA Bacterial Glycerol Stock
spectrin repeat containing, nuclear envelope family member 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172500.2-1109s21c1
Sequence:CCGGCCGTGTAGACCGGTTACAAACCTCGAGGTTTGTAACCGGTCTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172500.2-2830s21c1
Sequence:CCGGCGCTCATGCTTCGGTACAATGCTCGAGCATTGTACCGAAGCATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172500.2-415s21c1
Sequence:CCGGTGCTGCACAACGTGGACAATCCTCGAGGATTGTCCACGTTGTGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172500.2-2403s21c1
Sequence:CCGGCTACGTAGAATCATCACAATGCTCGAGCATTGTGATGATTCTACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172500.2-3362s21c1
Sequence:CCGGTTGGGCCGTGGGCTAGATAAACTCGAGTTTATCTAGCCCACGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172500.1-1193s1c1
Sequence:CCGGCATTCAGGAATACCAAAGTATCTCGAGATACTTTGGTATTCCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172500.1-2234s1c1
Sequence:CCGGGCAGGTGTTCACCAACAACATCTCGAGATGTTGTTGGTGAACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172500.1-4843s1c1
Sequence:CCGGCCTGAGTTCCATGACCTGAATCTCGAGATTCAGGTCATGGAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172500
SYNE3 MISSION shRNA shRNA Plasmid DNA
spectrin repeat containing, nuclear envelope family member 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172500.2-1109s21c1
Sequence:CCGGCCGTGTAGACCGGTTACAAACCTCGAGGTTTGTAACCGGTCTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172500.2-2830s21c1
Sequence:CCGGCGCTCATGCTTCGGTACAATGCTCGAGCATTGTACCGAAGCATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172500.2-415s21c1
Sequence:CCGGTGCTGCACAACGTGGACAATCCTCGAGGATTGTCCACGTTGTGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172500.2-2403s21c1
Sequence:CCGGCTACGTAGAATCATCACAATGCTCGAGCATTGTGATGATTCTACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172500.2-3362s21c1
Sequence:CCGGTTGGGCCGTGGGCTAGATAAACTCGAGTTTATCTAGCCCACGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172500.1-1193s1c1
Sequence:CCGGCATTCAGGAATACCAAAGTATCTCGAGATACTTTGGTATTCCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172500.1-2234s1c1
Sequence:CCGGGCAGGTGTTCACCAACAACATCTCGAGATGTTGTTGGTGAACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172500.1-4843s1c1
Sequence:CCGGCCTGAGTTCCATGACCTGAATCTCGAGATTCAGGTCATGGAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172500
SYNE3 MISSION shRNA Lentiviral Transduction Particles
spectrin repeat containing, nuclear envelope family member 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172500.2-1109s21c1
Sequence:CCGGCCGTGTAGACCGGTTACAAACCTCGAGGTTTGTAACCGGTCTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172500.2-2830s21c1
Sequence:CCGGCGCTCATGCTTCGGTACAATGCTCGAGCATTGTACCGAAGCATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172500.2-415s21c1
Sequence:CCGGTGCTGCACAACGTGGACAATCCTCGAGGATTGTCCACGTTGTGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172500.2-2403s21c1
Sequence:CCGGCTACGTAGAATCATCACAATGCTCGAGCATTGTGATGATTCTACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172500.2-3362s21c1
Sequence:CCGGTTGGGCCGTGGGCTAGATAAACTCGAGTTTATCTAGCCCACGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172500.1-1193s1c1
Sequence:CCGGCATTCAGGAATACCAAAGTATCTCGAGATACTTTGGTATTCCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172500.1-2234s1c1
Sequence:CCGGGCAGGTGTTCACCAACAACATCTCGAGATGTTGTTGGTGAACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172500.1-4843s1c1
Sequence:CCGGCCTGAGTTCCATGACCTGAATCTCGAGATTCAGGTCATGGAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152592
SYNE3 MISSION shRNA Bacterial Glycerol Stock
spectrin repeat containing, nuclear envelope family member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152592.3-1008s21c1
Sequence:CCGGAGCCTGGGAGCAGCAGATTAACTCGAGTTAATCTGCTGCTCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152592.3-2380s21c1
Sequence:CCGGCATCGTCGACGCGCAAATCTTCTCGAGAAGATTTGCGCGTCGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152592.3-2573s21c1
Sequence:CCGGCAGAAGGTCAGCATCTCTTTGCTCGAGCAAAGAGATGCTGACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152592.3-2353s21c1
Sequence:CCGGATCAATCCCATGGATCCTATTCTCGAGAATAGGATCCATGGGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152592.3-3048s21c1
Sequence:CCGGCTGCAGAGCTGCATCCATATCCTCGAGGATATGGATGCAGCTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152592.2-801s1c1
Sequence:CCGGGCAGGACATTGCCAAAGATTTCTCGAGAAATCTTTGGCAATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152592.2-2664s1c1
Sequence:CCGGGCTGTACAAGTCCAAGCTGAACTCGAGTTCAGCTTGGACTTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152592.2-2391s1c1
Sequence:CCGGCGCAAATCTTCTACAGGAAGACTCGAGTCTTCCTGTAGAAGATTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152592
SYNE3 MISSION shRNA shRNA Plasmid DNA
spectrin repeat containing, nuclear envelope family member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152592.3-1008s21c1
Sequence:CCGGAGCCTGGGAGCAGCAGATTAACTCGAGTTAATCTGCTGCTCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152592.3-2380s21c1
Sequence:CCGGCATCGTCGACGCGCAAATCTTCTCGAGAAGATTTGCGCGTCGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152592.3-2573s21c1
Sequence:CCGGCAGAAGGTCAGCATCTCTTTGCTCGAGCAAAGAGATGCTGACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152592.3-2353s21c1
Sequence:CCGGATCAATCCCATGGATCCTATTCTCGAGAATAGGATCCATGGGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152592.3-3048s21c1
Sequence:CCGGCTGCAGAGCTGCATCCATATCCTCGAGGATATGGATGCAGCTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152592.2-801s1c1
Sequence:CCGGGCAGGACATTGCCAAAGATTTCTCGAGAAATCTTTGGCAATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152592.2-2664s1c1
Sequence:CCGGGCTGTACAAGTCCAAGCTGAACTCGAGTTCAGCTTGGACTTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152592.2-2391s1c1
Sequence:CCGGCGCAAATCTTCTACAGGAAGACTCGAGTCTTCCTGTAGAAGATTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152592
SYNE3 MISSION shRNA Lentiviral Transduction Particles
spectrin repeat containing, nuclear envelope family member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152592.3-1008s21c1
Sequence:CCGGAGCCTGGGAGCAGCAGATTAACTCGAGTTAATCTGCTGCTCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152592.3-2380s21c1
Sequence:CCGGCATCGTCGACGCGCAAATCTTCTCGAGAAGATTTGCGCGTCGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152592.3-2573s21c1
Sequence:CCGGCAGAAGGTCAGCATCTCTTTGCTCGAGCAAAGAGATGCTGACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152592.3-2353s21c1
Sequence:CCGGATCAATCCCATGGATCCTATTCTCGAGAATAGGATCCATGGGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152592.3-3048s21c1
Sequence:CCGGCTGCAGAGCTGCATCCATATCCTCGAGGATATGGATGCAGCTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152592.2-801s1c1
Sequence:CCGGGCAGGACATTGCCAAAGATTTCTCGAGAAATCTTTGGCAATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152592.2-2664s1c1
Sequence:CCGGGCTGTACAAGTCCAAGCTGAACTCGAGTTCAGCTTGGACTTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152592.2-2391s1c1
Sequence:CCGGCGCAAATCTTCTACAGGAAGACTCGAGTCTTCCTGTAGAAGATTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks