EMAIL THIS PAGE TO A FRIEND

SYNE4

spectrin repeat containing, nuclear envelope family member 4

Synonyms: C19orf46 Nesp4
UniProtKB ID: Q8N205, A8MRS0, A8MYE3, Q7Z7L3
Gene ID:
Mouse(233066) spectrin repeat containing, nuclear envelope family member 4
Rat(292781) spectrin repeat containing, nuclear envelope family member 4
cow(509061) spectrin repeat containing, nuclear envelope family member 4
sheep(101119662) spectrin repeat containing, nuclear envelope family member 4
naked mole-rat(101709081) spectrin repeat containing, nuclear envelope family member 4
domestic guinea pig(100726927) spectrin repeat containing, nuclear envelope family member 4
domestic cat(101082452) spectrin repeat containing, nuclear envelope family member 4
dog(612623) spectrin repeat containing, nuclear envelope family member 4
Gene Class: Cytoskeleton
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153233 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039876 Rosetta Predictions human pricing
NM_001009283 Rosetta Predictions rat pricing
NM_153577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201767 predicted 711
2 SASI_Hs01_00201768 predicted 370
3 SASI_Hs02_00308693 predicted 384
4 SASI_Hs01_00201769 predicted 634
5 SASI_Hs01_00201770 predicted 889
6 SASI_Hs01_00201771 predicted 385
7 SASI_Hs01_00201772 predicted 805
8 SASI_Hs01_00201773 predicted 390
9 SASI_Hs01_00201774 predicted 324
10 SASI_Hs01_00201775 predicted 819
11 SASI_Hs01_00201776 predicted 1339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054161 predicted 680
2 SASI_Rn01_00054163 predicted 536
3 SASI_Rn01_00054164 predicted 373
4 SASI_Rn01_00054165 predicted 880
5 SASI_Rn01_00054166 predicted 541
6 SASI_Rn02_00199506 predicted 374
7 SASI_Rn02_00199507 predicted 371
8 SASI_Rn02_00199508 predicted 680
9 SASI_Rn01_00054168 predicted 811
10 SASI_Rn02_00199509 predicted 760
11 SASI_Rn01_00054162 predicted 529
12 SASI_Rn01_00054167 predicted 728
13 SASI_Rn01_00054169 predicted 233
14 SASI_Rn01_00054170 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175089 predicted 891
2 SASI_Mm01_00175090 predicted 733
3 SASI_Mm01_00175091 predicted 415
4 SASI_Mm01_00175092 predicted 300
5 SASI_Mm02_00343383 predicted 408
6 SASI_Mm01_00175093 predicted 1065
7 SASI_Mm01_00175094 predicted 459
8 SASI_Mm01_00175096 predicted 433
9 SASI_Mm02_00343384 predicted 938
10 SASI_Mm01_00175097 predicted 204
11 SASI_Mm01_00175095 predicted 443
12 SASI_Mm01_00175098 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153577
SYNE4 MISSION shRNA Bacterial Glycerol Stock
spectrin repeat containing, nuclear envelope family member 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000196020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153577.1-425s1c1
Sequence:CCGGGAAGCTGAACAGGACAGTCTACTCGAGTAGACTGTCCTGTTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153577.1-398s1c1
Sequence:CCGGCACTCTGACTCTGGTTTGGAACTCGAGTTCCAAACCAGAGTCAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153577.1-517s1c1
Sequence:CCGGCCACAACAGGATTGTCCAGATCTCGAGATCTGGACAATCCTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153577.1-1153s1c1
Sequence:CCGGCCTCTTCTTTCTCCTTCTCTTCTCGAGAAGAGAAGGAGAAAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153577
SYNE4 MISSION shRNA shRNA Plasmid DNA
spectrin repeat containing, nuclear envelope family member 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000196020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153577.1-425s1c1
Sequence:CCGGGAAGCTGAACAGGACAGTCTACTCGAGTAGACTGTCCTGTTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153577.1-398s1c1
Sequence:CCGGCACTCTGACTCTGGTTTGGAACTCGAGTTCCAAACCAGAGTCAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153577.1-517s1c1
Sequence:CCGGCCACAACAGGATTGTCCAGATCTCGAGATCTGGACAATCCTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153577.1-1153s1c1
Sequence:CCGGCCTCTTCTTTCTCCTTCTCTTCTCGAGAAGAGAAGGAGAAAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153577
SYNE4 MISSION shRNA Lentiviral Transduction Particles
spectrin repeat containing, nuclear envelope family member 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000196020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153577.1-425s1c1
Sequence:CCGGGAAGCTGAACAGGACAGTCTACTCGAGTAGACTGTCCTGTTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153577.1-398s1c1
Sequence:CCGGCACTCTGACTCTGGTTTGGAACTCGAGTTCCAAACCAGAGTCAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153577.1-517s1c1
Sequence:CCGGCCACAACAGGATTGTCCAGATCTCGAGATCTGGACAATCCTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153577.1-1153s1c1
Sequence:CCGGCCTCTTCTTTCTCCTTCTCTTCTCGAGAAGAGAAGGAGAAAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153233
SYNE4 MISSION shRNA Bacterial Glycerol Stock
spectrin repeat containing, nuclear envelope family member 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153233.1-1144s1c1
Sequence:CCGGCCATCTCAAATTCACTCCTATCTCGAGATAGGAGTGAATTTGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144245    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-1307s1c1
Sequence:CCGGCAGCTTGACTTTGCACATTTACTCGAGTAAATGTGCAAAGTCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153233.1-1633s1c1
Sequence:CCGGCCAGGCCTCATTTACTTATTACTCGAGTAATAAGTAAATGAGGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153233.1-1304s1c1
Sequence:CCGGCCACAGCTTGACTTTGCACATCTCGAGATGTGCAAAGTCAAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153233.1-1265s1c1
Sequence:CCGGGCACTCCTATCTTCTTACTTTCTCGAGAAAGTAAGAAGATAGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153233.1-1871s1c1
Sequence:CCGGCTCATCTCTATGACATCCCTACTCGAGTAGGGATGTCATAGAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153233.1-1114s1c1
Sequence:CCGGCTCGTCTGTCTCTGTCTACATCTCGAGATGTAGACAGAGACAGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-2142s1c1
Sequence:CCGGCCTTATCCTCTTCCTCCTCTTCTCGAGAAGAGGAGGAAGAGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-1432s1c1
Sequence:CCGGCAGGTTCAAGAGATTCTCCTACTCGAGTAGGAGAATCTCTTGAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153233.1-1117s1c1
Sequence:CCGGGTCTGTCTCTGTCTACATCCTCTCGAGAGGATGTAGACAGAGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139895    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-1691s1c1
Sequence:CCGGGAGGCCAGGAATTTGCCTATTCTCGAGAATAGGCAAATTCCTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-1831s1c1
Sequence:CCGGCCTTTGTCTGTCCTGTGAGATCTCGAGATCTCACAGGACAGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153233
SYNE4 MISSION shRNA shRNA Plasmid DNA
spectrin repeat containing, nuclear envelope family member 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153233.1-1144s1c1
Sequence:CCGGCCATCTCAAATTCACTCCTATCTCGAGATAGGAGTGAATTTGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144245    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-1307s1c1
Sequence:CCGGCAGCTTGACTTTGCACATTTACTCGAGTAAATGTGCAAAGTCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153233.1-1633s1c1
Sequence:CCGGCCAGGCCTCATTTACTTATTACTCGAGTAATAAGTAAATGAGGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153233.1-1304s1c1
Sequence:CCGGCCACAGCTTGACTTTGCACATCTCGAGATGTGCAAAGTCAAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153233.1-1265s1c1
Sequence:CCGGGCACTCCTATCTTCTTACTTTCTCGAGAAAGTAAGAAGATAGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153233.1-1871s1c1
Sequence:CCGGCTCATCTCTATGACATCCCTACTCGAGTAGGGATGTCATAGAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153233.1-1114s1c1
Sequence:CCGGCTCGTCTGTCTCTGTCTACATCTCGAGATGTAGACAGAGACAGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-2142s1c1
Sequence:CCGGCCTTATCCTCTTCCTCCTCTTCTCGAGAAGAGGAGGAAGAGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-1432s1c1
Sequence:CCGGCAGGTTCAAGAGATTCTCCTACTCGAGTAGGAGAATCTCTTGAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153233.1-1117s1c1
Sequence:CCGGGTCTGTCTCTGTCTACATCCTCTCGAGAGGATGTAGACAGAGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139895    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-1691s1c1
Sequence:CCGGGAGGCCAGGAATTTGCCTATTCTCGAGAATAGGCAAATTCCTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-1831s1c1
Sequence:CCGGCCTTTGTCTGTCCTGTGAGATCTCGAGATCTCACAGGACAGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153233
SYNE4 MISSION shRNA Lentiviral Transduction Particles
spectrin repeat containing, nuclear envelope family member 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153233.1-1144s1c1
Sequence:CCGGCCATCTCAAATTCACTCCTATCTCGAGATAGGAGTGAATTTGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144245    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-1307s1c1
Sequence:CCGGCAGCTTGACTTTGCACATTTACTCGAGTAAATGTGCAAAGTCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153233.1-1633s1c1
Sequence:CCGGCCAGGCCTCATTTACTTATTACTCGAGTAATAAGTAAATGAGGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153233.1-1304s1c1
Sequence:CCGGCCACAGCTTGACTTTGCACATCTCGAGATGTGCAAAGTCAAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153233.1-1265s1c1
Sequence:CCGGGCACTCCTATCTTCTTACTTTCTCGAGAAAGTAAGAAGATAGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153233.1-1871s1c1
Sequence:CCGGCTCATCTCTATGACATCCCTACTCGAGTAGGGATGTCATAGAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153233.1-1114s1c1
Sequence:CCGGCTCGTCTGTCTCTGTCTACATCTCGAGATGTAGACAGAGACAGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-2142s1c1
Sequence:CCGGCCTTATCCTCTTCCTCCTCTTCTCGAGAAGAGGAGGAAGAGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-1432s1c1
Sequence:CCGGCAGGTTCAAGAGATTCTCCTACTCGAGTAGGAGAATCTCTTGAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153233.1-1117s1c1
Sequence:CCGGGTCTGTCTCTGTCTACATCCTCTCGAGAGGATGTAGACAGAGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139895    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-1691s1c1
Sequence:CCGGGAGGCCAGGAATTTGCCTATTCTCGAGAATAGGCAAATTCCTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153233.1-1831s1c1
Sequence:CCGGCCTTTGTCTGTCCTGTGAGATCTCGAGATCTCACAGGACAGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks