EMAIL THIS PAGE TO A FRIEND

SYNGAP1

synaptic Ras GTPase activating protein 1

Synonyms: MRD5 RASA1 RASA5 SYNGAP
Gene ID:
Human(8831) Summary: The protein encoded by this gene is a major component of the postsynaptic density (PSD), a group of proteins found associated with NMDA receptors at synapses. The encoded protein is phosphorylated by calmodulin-dependent protein kinase II and dephosphorylated by NMDA receptor activation. Defects in this gene are a cause of mental retardation autosomal dominant type 5 (MRD5). [provided by RefSeq, Dec 2009]
Mouse(240057) synaptic Ras GTPase activating protein 1 homolog (rat)
Rat(192117) synaptic Ras GTPase activating protein 1
Zebrafish(100034226) synaptic Ras GTPase activating protein 1 homolog (rat)
domestic cat(101092938) synaptic Ras GTPase activating protein 1
Horse(100147004) synaptic Ras GTPase activating protein 1
dog(481742) synaptic Ras GTPase activating protein 1
naked mole-rat(101710189) synaptic Ras GTPase activating protein 1
cow(790307) synaptic Ras GTPase activating protein 1
sheep(101117886) synaptic Ras GTPase activating protein 1
247 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0080 AQUA Peptide EFAEYVTNHY[R] dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006772 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_139847 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_139847 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_139847 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006772 Rosetta Predictions human pricing
NM_001113409 Rosetta Predictions rat pricing
NM_181092 Rosetta Predictions rat pricing
XM_915205 Rosetta Predictions mouse pricing
XM_985548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105137 predicted 2589
2 SASI_Hs01_00105138 predicted 932
3 SASI_Hs01_00105139 predicted 979
4 SASI_Hs01_00105140 predicted 787
5 SASI_Hs01_00105141 predicted 1827
6 SASI_Hs01_00105142 predicted 1682
7 SASI_Hs01_00105143 predicted 1954
8 SASI_Hs01_00105144 predicted 2516
9 SASI_Hs01_00105145 predicted 2004
10 SASI_Hs01_00105146 predicted 3925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251823 predicted 838
2 SASI_Rn02_00251824 predicted 3689
3 SASI_Rn02_00251825 predicted 662
4 SASI_Rn02_00251826 predicted 3628
5 SASI_Rn02_00251827 predicted 844
6 SASI_Rn02_00251828 predicted 1464
7 SASI_Rn02_00251829 predicted 796
8 SASI_Rn02_00251830 predicted 1974
9 SASI_Rn02_00251831 predicted 1766
10 SASI_Rn02_00251832 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034175 predicted 896
2 SASI_Rn01_00034176 predicted 3750
3 SASI_Rn01_00034177 predicted 727
4 SASI_Rn01_00034178 predicted 3686
5 SASI_Rn01_00034179 predicted 911
6 SASI_Rn01_00034180 predicted 1533
7 SASI_Rn01_00034181 predicted 855
8 SASI_Rn01_00034182 predicted 2034
9 SASI_Rn01_00034183 predicted 1827
10 SASI_Rn02_00269676 predicted 933
11 SASI_Rn01_00034184 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915205 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439238 predicted 3565
2 SASI_Mm02_00439239 predicted 666
3 SASI_Mm02_00439240 predicted 1503
4 SASI_Mm02_00439241 predicted 2159
5 SASI_Mm02_00439242 predicted 2441
6 SASI_Mm02_00439243 predicted 1353
7 SASI_Mm02_00439244 predicted 1480
8 SASI_Mm02_00439245 predicted 1922
9 SASI_Mm02_00439246 predicted 1713
10 SASI_Mm02_00439247 predicted 1587
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_985548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203704 predicted 667
2 SASI_Mm01_00203705 predicted 1496
3 SASI_Mm01_00203706 predicted 2160
4 SASI_Mm01_00203707 predicted 2441
5 SASI_Mm01_00203708 predicted 1355
6 SASI_Mm02_00448789 predicted 1483
7 SASI_Mm01_00203711 predicted 1919
8 SASI_Mm01_00203712 predicted 1712
9 SASI_Mm01_00203713 predicted 1586
10 SASI_Mm02_00448790 predicted 1923
11 SASI_Mm01_00203709 predicted 1754
12 SASI_Mm01_00203710 predicted 2279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006772
SYNGAP1 MISSION shRNA Bacterial Glycerol Stock
synaptic Ras GTPase activating protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006772.1-969s1c1
Sequence:CCGGCCGGGTAGACAATGTGCTAAACTCGAGTTTAGCACATTGTCTACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006772.1-3126s1c1
Sequence:CCGGCCCATTCCATGGCTATAGCAACTCGAGTTGCTATAGCCATGGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006772.1-3793s1c1
Sequence:CCGGGAGGAGATTCACTCACTGAAACTCGAGTTTCAGTGAGTGAATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006772.1-4592s1c1
Sequence:CCGGGCACCTCCAAACTTTCAACTTCTCGAGAAGTTGAAAGTTTGGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006772.1-1457s1c1
Sequence:CCGGCAGAGTATGTCACCAACCATTCTCGAGAATGGTTGGTGACATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006772.1-2223s1c1
Sequence:CCGGCAGTAGCTTTGAGGGTTACATCTCGAGATGTAACCCTCAAAGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006772.1-622s1c1
Sequence:CCGGCGAACGAAGTCACAACCCAAACTCGAGTTTGGGTTGTGACTTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006772.1-1456s1c1
Sequence:CCGGGCAGAGTATGTCACCAACCATCTCGAGATGGTTGGTGACATACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006772.2-1627s1c1
Sequence:CCGGGAACGGGAGCACCTCATATTCCTCGAGGAATATGAGGTGCTCCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006772.2-5571s1c1
Sequence:CCGGGGGCCAAATTTATACTTATATCTCGAGATATAAGTATAAATTTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006772
SYNGAP1 MISSION shRNA shRNA Plasmid DNA
synaptic Ras GTPase activating protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006772.1-969s1c1
Sequence:CCGGCCGGGTAGACAATGTGCTAAACTCGAGTTTAGCACATTGTCTACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006772.1-3126s1c1
Sequence:CCGGCCCATTCCATGGCTATAGCAACTCGAGTTGCTATAGCCATGGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006772.1-3793s1c1
Sequence:CCGGGAGGAGATTCACTCACTGAAACTCGAGTTTCAGTGAGTGAATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006772.1-4592s1c1
Sequence:CCGGGCACCTCCAAACTTTCAACTTCTCGAGAAGTTGAAAGTTTGGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006772.1-1457s1c1
Sequence:CCGGCAGAGTATGTCACCAACCATTCTCGAGAATGGTTGGTGACATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006772.1-2223s1c1
Sequence:CCGGCAGTAGCTTTGAGGGTTACATCTCGAGATGTAACCCTCAAAGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006772.1-622s1c1
Sequence:CCGGCGAACGAAGTCACAACCCAAACTCGAGTTTGGGTTGTGACTTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006772.1-1456s1c1
Sequence:CCGGGCAGAGTATGTCACCAACCATCTCGAGATGGTTGGTGACATACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006772.2-1627s1c1
Sequence:CCGGGAACGGGAGCACCTCATATTCCTCGAGGAATATGAGGTGCTCCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006772.2-5571s1c1
Sequence:CCGGGGGCCAAATTTATACTTATATCTCGAGATATAAGTATAAATTTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006772
SYNGAP1 MISSION shRNA Lentiviral Transduction Particles
synaptic Ras GTPase activating protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006772.1-969s1c1
Sequence:CCGGCCGGGTAGACAATGTGCTAAACTCGAGTTTAGCACATTGTCTACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006772.1-3126s1c1
Sequence:CCGGCCCATTCCATGGCTATAGCAACTCGAGTTGCTATAGCCATGGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006772.1-3793s1c1
Sequence:CCGGGAGGAGATTCACTCACTGAAACTCGAGTTTCAGTGAGTGAATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006772.1-4592s1c1
Sequence:CCGGGCACCTCCAAACTTTCAACTTCTCGAGAAGTTGAAAGTTTGGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006772.1-1457s1c1
Sequence:CCGGCAGAGTATGTCACCAACCATTCTCGAGAATGGTTGGTGACATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006772.1-2223s1c1
Sequence:CCGGCAGTAGCTTTGAGGGTTACATCTCGAGATGTAACCCTCAAAGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006772.1-622s1c1
Sequence:CCGGCGAACGAAGTCACAACCCAAACTCGAGTTTGGGTTGTGACTTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006772.1-1456s1c1
Sequence:CCGGGCAGAGTATGTCACCAACCATCTCGAGATGGTTGGTGACATACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006772.2-1627s1c1
Sequence:CCGGGAACGGGAGCACCTCATATTCCTCGAGGAATATGAGGTGCTCCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006772.2-5571s1c1
Sequence:CCGGGGGCCAAATTTATACTTATATCTCGAGATATAAGTATAAATTTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_139847
SYNGAP1 MISSION shRNA Bacterial Glycerol Stock
synaptic Ras GTPase activating protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-597s1c1
Sequence:CCGGCCGAGTAGATAACGTGCTGAACTCGAGTTCAGCACGTTATCTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-420s1c1
Sequence:CCGGCCTGGATGAAGACTCCATTATCTCGAGATAATGGAGTCTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-2495s1c1
Sequence:CCGGGCCTTAACAGTAGCAGTGTTTCTCGAGAAACACTGCTACTGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-1084s1c1
Sequence:CCGGGCAGAGTATGTGACCAACCATCTCGAGATGGTTGGTCACATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-1746s1c1
Sequence:CCGGGCCCAGTCTATTTGGGCTTATCTCGAGATAAGCCCAAATAGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_139847
SYNGAP1 MISSION shRNA shRNA Plasmid DNA
synaptic Ras GTPase activating protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-597s1c1
Sequence:CCGGCCGAGTAGATAACGTGCTGAACTCGAGTTCAGCACGTTATCTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-420s1c1
Sequence:CCGGCCTGGATGAAGACTCCATTATCTCGAGATAATGGAGTCTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-2495s1c1
Sequence:CCGGGCCTTAACAGTAGCAGTGTTTCTCGAGAAACACTGCTACTGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-1084s1c1
Sequence:CCGGGCAGAGTATGTGACCAACCATCTCGAGATGGTTGGTCACATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-1746s1c1
Sequence:CCGGGCCCAGTCTATTTGGGCTTATCTCGAGATAAGCCCAAATAGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_139847
SYNGAP1 MISSION shRNA Lentiviral Transduction Particles
synaptic Ras GTPase activating protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-597s1c1
Sequence:CCGGCCGAGTAGATAACGTGCTGAACTCGAGTTCAGCACGTTATCTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-420s1c1
Sequence:CCGGCCTGGATGAAGACTCCATTATCTCGAGATAATGGAGTCTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-2495s1c1
Sequence:CCGGGCCTTAACAGTAGCAGTGTTTCTCGAGAAACACTGCTACTGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-1084s1c1
Sequence:CCGGGCAGAGTATGTGACCAACCATCTCGAGATGGTTGGTCACATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139847.2-1746s1c1
Sequence:CCGGGCCCAGTCTATTTGGGCTTATCTCGAGATAAGCCCAAATAGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks