EMAIL THIS PAGE TO A FRIEND

SYNGR1

synaptogyrin 1

Gene ID:
Human(9145) Summary: This gene encodes an integral membrane protein associated with presynaptic vesicles in neuronal cells. The exact function of this protein is unclear, but studies of a similar murine protein suggest that it functions in synaptic plasticity without being required for synaptic transmission. The gene product belongs to the synaptogyrin gene family. Three alternatively spliced variants encoding three different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(20972) synaptogyrin 1
Rat(29205) synaptogyrin 1
cow(534995) synaptogyrin 1
chicken(418015) synaptogyrin 1
domestic cat(101096580) synaptogyrin 1
dog(610027) synaptogyrin 1
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004711 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004711 Rosetta Predictions human pricing
NM_145731 Rosetta Predictions human pricing
NM_145738 Rosetta Predictions human pricing
NM_019166 Rosetta Predictions rat pricing
NM_009303 Rosetta Predictions mouse pricing
NM_207708 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163126 predicted 278
2 SASI_Hs01_00163127 predicted 271
3 SASI_Hs01_00163128 predicted 277
4 SASI_Hs01_00163129 predicted 326
5 SASI_Hs02_00338172 predicted 226
6 SASI_Hs01_00163130 predicted 930
7 SASI_Hs01_00163131 predicted 1245
8 SASI_Hs01_00163132 predicted 680
9 SASI_Hs01_00163133 predicted 940
10 SASI_Hs01_00163134 predicted 1208
11 SASI_Hs01_00163135 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117368 predicted 367
2 SASI_Hs01_00117369 predicted 556
3 SASI_Hs01_00117370 predicted 455
4 SASI_Hs01_00117372 predicted 566
5 SASI_Hs01_00117373 predicted 388
6 SASI_Hs01_00117374 predicted 552
7 SASI_Hs01_00117375 predicted 553
8 SASI_Hs01_00117376 predicted 560
9 SASI_Hs01_00117377 predicted 461
10 SASI_Hs02_00365328 predicted 461
11 SASI_Hs01_00117371 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191676 predicted 339
2 SASI_Hs01_00191677 predicted 517
3 SASI_Hs01_00191678 predicted 412
4 SASI_Hs01_00191680 predicted 539
5 SASI_Hs01_00191681 predicted 363
6 SASI_Hs01_00191682 predicted 521
7 SASI_Hs01_00191683 predicted 517
8 SASI_Hs01_00191684 predicted 522
9 SASI_Hs01_00191685 predicted 429
10 SASI_Hs02_00365332 predicted 422
11 SASI_Hs01_00191679 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034342 predicted 343
2 SASI_Rn01_00034343 predicted 450
3 SASI_Rn02_00261954 predicted 208
4 SASI_Rn01_00034344 predicted 319
5 SASI_Rn01_00034345 predicted 543
6 SASI_Rn01_00034346 predicted 292
7 SASI_Rn01_00034347 predicted 337
8 SASI_Rn01_00034348 predicted 432
9 SASI_Rn01_00034349 predicted 351
10 SASI_Rn01_00034350 predicted 295
11 SASI_Rn01_00034351 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041284 predicted 268
2 SASI_Mm01_00041285 predicted 255
3 SASI_Mm01_00041286 predicted 224
4 SASI_Mm02_00315832 predicted 216
5 SASI_Mm01_00041287 predicted 308
6 SASI_Mm01_00041288 predicted 277
7 SASI_Mm01_00041289 predicted 220
8 SASI_Mm02_00315833 predicted 216
9 SASI_Mm01_00041290 predicted 307
10 SASI_Mm01_00041291 predicted 224
11 SASI_Mm01_00041292 predicted 281
12 SASI_Mm01_00041293 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165844 predicted 270
2 SASI_Mm01_00165845 predicted 252
3 SASI_Mm01_00165846 predicted 218
4 SASI_Mm02_00352246 predicted 216
5 SASI_Mm01_00165847 predicted 305
6 SASI_Mm01_00165848 predicted 277
7 SASI_Mm01_00165849 predicted 223
8 SASI_Mm02_00352247 predicted 224
9 SASI_Mm01_00165850 predicted 302
10 SASI_Mm01_00165851 predicted 229
11 SASI_Mm01_00165852 predicted 286
12 SASI_Mm01_00165853 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009303
VALIDATED
SYNGR1 MISSION shRNA Bacterial Glycerol Stock
synaptogyrin 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009303.2-192s21c1
Sequence:CCGGGAACGAGGGCTACCTCAACAACTCGAGTTGTTGAGGTAGCCCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009303.2-596s21c1
Sequence:CCGGAGGAATACAACACACTGTTCCCTCGAGGGAACAGTGTGTTGTATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009303.2-582s21c1
Sequence:CCGGGCTTACCTTCCAGGAGGAATACTCGAGTATTCCTCCTGGAAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009303.1-618s1c1
Sequence:CCGGCCCTGAAGGACAGGGAGTCTACTCGAGTAGACTCCCTGTCCTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009303.1-316s1c1
Sequence:CCGGCCCGCAGATCAGCAGTGTCAACTCGAGTTGACACTGCTGATCTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009303.1-124s1c1
Sequence:CCGGGCGCGTCGTGTCTTGGGTCTTCTCGAGAAGACCCAAGACACGACGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009303.1-211s1c1
Sequence:CCGGGTTCTGCATCTACAACCGCAACTCGAGTTGCGGTTGTAGATGCAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009303.1-545s1c1
Sequence:CCGGGTACGCAGATTCAAGGAGCTTCTCGAGAAGCTCCTTGAATCTGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009303
VALIDATED
SYNGR1 MISSION shRNA shRNA Plasmid DNA
synaptogyrin 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009303.2-192s21c1
Sequence:CCGGGAACGAGGGCTACCTCAACAACTCGAGTTGTTGAGGTAGCCCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009303.2-596s21c1
Sequence:CCGGAGGAATACAACACACTGTTCCCTCGAGGGAACAGTGTGTTGTATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009303.2-582s21c1
Sequence:CCGGGCTTACCTTCCAGGAGGAATACTCGAGTATTCCTCCTGGAAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009303.1-618s1c1
Sequence:CCGGCCCTGAAGGACAGGGAGTCTACTCGAGTAGACTCCCTGTCCTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009303.1-316s1c1
Sequence:CCGGCCCGCAGATCAGCAGTGTCAACTCGAGTTGACACTGCTGATCTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009303.1-124s1c1
Sequence:CCGGGCGCGTCGTGTCTTGGGTCTTCTCGAGAAGACCCAAGACACGACGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009303.1-211s1c1
Sequence:CCGGGTTCTGCATCTACAACCGCAACTCGAGTTGCGGTTGTAGATGCAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009303.1-545s1c1
Sequence:CCGGGTACGCAGATTCAAGGAGCTTCTCGAGAAGCTCCTTGAATCTGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009303
VALIDATED
SYNGR1 MISSION shRNA Lentiviral Transduction Particles
synaptogyrin 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009303.2-192s21c1
Sequence:CCGGGAACGAGGGCTACCTCAACAACTCGAGTTGTTGAGGTAGCCCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009303.2-596s21c1
Sequence:CCGGAGGAATACAACACACTGTTCCCTCGAGGGAACAGTGTGTTGTATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009303.2-582s21c1
Sequence:CCGGGCTTACCTTCCAGGAGGAATACTCGAGTATTCCTCCTGGAAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009303.1-618s1c1
Sequence:CCGGCCCTGAAGGACAGGGAGTCTACTCGAGTAGACTCCCTGTCCTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009303.1-316s1c1
Sequence:CCGGCCCGCAGATCAGCAGTGTCAACTCGAGTTGACACTGCTGATCTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009303.1-124s1c1
Sequence:CCGGGCGCGTCGTGTCTTGGGTCTTCTCGAGAAGACCCAAGACACGACGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009303.1-211s1c1
Sequence:CCGGGTTCTGCATCTACAACCGCAACTCGAGTTGCGGTTGTAGATGCAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009303.1-545s1c1
Sequence:CCGGGTACGCAGATTCAAGGAGCTTCTCGAGAAGCTCCTTGAATCTGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004711
SYNGR1 MISSION shRNA Bacterial Glycerol Stock
synaptogyrin 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004711.4-156s21c1
Sequence:CCGGTCTTGGCTGTTCTCCATAGTGCTCGAGCACTATGGAGAACAGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004711.4-934s21c1
Sequence:CCGGTCTACGTATGTGCAAGTATATCTCGAGATATACTTGCACATACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004711.4-228s21c1
Sequence:CCGGGAGGAGTTCTGCATCTACAACCTCGAGGTTGTAGATGCAGAACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004711.4-351s21c1
Sequence:CCGGAGCGTCAAGGACCGCAAGAAACTCGAGTTTCTTGCGGTCCTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004711.4-328s21c1
Sequence:CCGGACGTGTACTTCCCGCAGATCACTCGAGTGATCTGCGGGAAGTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-1462s1c1
Sequence:CCGGCCTGCTCAGTGTTACTGTCATCTCGAGATGACAGTAACACTGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-2903s1c1
Sequence:CCGGGCCTGAAGAGTGAAACCTGTACTCGAGTACAGGTTTCACTCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163120    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-2795s1c1
Sequence:CCGGGCTGGTTGTTGCTGACTTCATCTCGAGATGAAGTCAGCAACAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004711.3-233s1c1
Sequence:CCGGGTTCTGCATCTACAACCGCAACTCGAGTTGCGGTTGTAGATGCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-2637s1c1
Sequence:CCGGGCAGAGAAGTAGCACCATTATCTCGAGATAATGGTGCTACTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-2707s1c1
Sequence:CCGGGCAGTGGAACACGGATCTAAACTCGAGTTTAGATCCGTGTTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-3239s1c1
Sequence:CCGGGCTGAGTCATCTCACGAAGAACTCGAGTTCTTCGTGAGATGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004711
SYNGR1 MISSION shRNA shRNA Plasmid DNA
synaptogyrin 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004711.4-156s21c1
Sequence:CCGGTCTTGGCTGTTCTCCATAGTGCTCGAGCACTATGGAGAACAGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004711.4-934s21c1
Sequence:CCGGTCTACGTATGTGCAAGTATATCTCGAGATATACTTGCACATACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004711.4-228s21c1
Sequence:CCGGGAGGAGTTCTGCATCTACAACCTCGAGGTTGTAGATGCAGAACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004711.4-351s21c1
Sequence:CCGGAGCGTCAAGGACCGCAAGAAACTCGAGTTTCTTGCGGTCCTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004711.4-328s21c1
Sequence:CCGGACGTGTACTTCCCGCAGATCACTCGAGTGATCTGCGGGAAGTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-1462s1c1
Sequence:CCGGCCTGCTCAGTGTTACTGTCATCTCGAGATGACAGTAACACTGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-2903s1c1
Sequence:CCGGGCCTGAAGAGTGAAACCTGTACTCGAGTACAGGTTTCACTCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163120    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-2795s1c1
Sequence:CCGGGCTGGTTGTTGCTGACTTCATCTCGAGATGAAGTCAGCAACAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004711.3-233s1c1
Sequence:CCGGGTTCTGCATCTACAACCGCAACTCGAGTTGCGGTTGTAGATGCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-2637s1c1
Sequence:CCGGGCAGAGAAGTAGCACCATTATCTCGAGATAATGGTGCTACTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-2707s1c1
Sequence:CCGGGCAGTGGAACACGGATCTAAACTCGAGTTTAGATCCGTGTTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-3239s1c1
Sequence:CCGGGCTGAGTCATCTCACGAAGAACTCGAGTTCTTCGTGAGATGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004711
SYNGR1 MISSION shRNA Lentiviral Transduction Particles
synaptogyrin 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004711.4-156s21c1
Sequence:CCGGTCTTGGCTGTTCTCCATAGTGCTCGAGCACTATGGAGAACAGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004711.4-934s21c1
Sequence:CCGGTCTACGTATGTGCAAGTATATCTCGAGATATACTTGCACATACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004711.4-228s21c1
Sequence:CCGGGAGGAGTTCTGCATCTACAACCTCGAGGTTGTAGATGCAGAACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004711.4-351s21c1
Sequence:CCGGAGCGTCAAGGACCGCAAGAAACTCGAGTTTCTTGCGGTCCTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004711.4-328s21c1
Sequence:CCGGACGTGTACTTCCCGCAGATCACTCGAGTGATCTGCGGGAAGTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-1462s1c1
Sequence:CCGGCCTGCTCAGTGTTACTGTCATCTCGAGATGACAGTAACACTGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-2903s1c1
Sequence:CCGGGCCTGAAGAGTGAAACCTGTACTCGAGTACAGGTTTCACTCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163120    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-2795s1c1
Sequence:CCGGGCTGGTTGTTGCTGACTTCATCTCGAGATGAAGTCAGCAACAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004711.3-233s1c1
Sequence:CCGGGTTCTGCATCTACAACCGCAACTCGAGTTGCGGTTGTAGATGCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-2637s1c1
Sequence:CCGGGCAGAGAAGTAGCACCATTATCTCGAGATAATGGTGCTACTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-2707s1c1
Sequence:CCGGGCAGTGGAACACGGATCTAAACTCGAGTTTAGATCCGTGTTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004711.3-3239s1c1
Sequence:CCGGGCTGAGTCATCTCACGAAGAACTCGAGTTCTTCGTGAGATGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks