EMAIL THIS PAGE TO A FRIEND

SYNGR2

synaptogyrin 2

UniProtKB ID: O43760, O43762, Q658S7
Gene ID:
Human(9144) Summary: This gene encodes an integral membrane protein containing four transmembrane regions and a C-terminal cytoplasmic tail that is tyrosine phosphorylated. The exact function of this protein is unclear, but studies of a similar rat protein suggest that it may play a role in regulating membrane traffic in non-neuronal cells. The gene belongs to the synaptogyrin gene family. [provided by RefSeq, Jul 2008]
Mouse(20973) synaptogyrin 2
Rat(89815) synaptogyrin 2
chicken(100859110) synaptogyrin 2
dog(100687829) synaptogyrin 2
naked mole-rat(101701078) synaptogyrin 2
cow(513812) synaptogyrin 2
sheep(101114289) synaptogyrin 2
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004710 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009304 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009304 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009304 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004710 Rosetta Predictions human pricing
NM_053553 Rosetta Predictions rat pricing
NM_009304 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221028 predicted 1056
2 SASI_Hs01_00221030 predicted 1062
3 SASI_Hs02_00338168 predicted 274
4 SASI_Hs02_00338169 predicted 164
5 SASI_Hs02_00338170 predicted 117
6 SASI_Hs02_00338171 predicted 165
7 SASI_Hs01_00221029 predicted 602
8 SASI_Hs01_00221031 predicted 621
9 SASI_Hs01_00221032 predicted 465
10 SASI_Hs01_00221033 predicted 901
11 SASI_Hs01_00221034 predicted 910
12 SASI_Hs01_00221035 predicted 650
13 SASI_Hs01_00221036 predicted 373
14 SASI_Hs01_00221037 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104572 predicted 346
2 SASI_Rn01_00104573 predicted 306
3 SASI_Rn01_00104574 predicted 694
4 SASI_Rn01_00104575 predicted 536
5 SASI_Rn01_00104576 predicted 586
6 SASI_Rn01_00104577 predicted 282
7 SASI_Rn01_00104578 predicted 429
8 SASI_Rn01_00104580 predicted 255
9 SASI_Rn02_00266207 predicted 619
10 SASI_Rn01_00104581 predicted 278
11 SASI_Rn01_00104579 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315834 predicted 200
2 SASI_Mm02_00315835 predicted 353
3 SASI_Mm01_00132617 predicted 321
4 SASI_Mm02_00315836 predicted 204
5 SASI_Mm02_00315837 predicted 225
6 SASI_Mm02_00315838 predicted 281
7 SASI_Mm01_00132610 predicted 994
8 SASI_Mm01_00132611 predicted 803
9 SASI_Mm01_00132612 predicted 554
10 SASI_Mm01_00132613 predicted 769
11 SASI_Mm01_00132614 predicted 1087
12 SASI_Mm01_00132615 predicted 970
13 SASI_Mm01_00132616 predicted 918
14 SASI_Mm01_00132618 predicted 654
15 SASI_Mm01_00132619 predicted 915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004710
SYNGR2 MISSION shRNA Bacterial Glycerol Stock
synaptogyrin 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-555s1c1
Sequence:CCGGGACTTCATCCAGAATTACGTTCTCGAGAACGTAATTCTGGATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-190s1c1
Sequence:CCGGCTAAGCAGATGTACTGCGTGTCTCGAGACACGCAGTACATCTGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-377s1c1
Sequence:CCGGCTTCCTGTGGTTTGTTGGTTTCTCGAGAAACCAACAAACCACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-471s1c1
Sequence:CCGGGCCATCACCTTCAGCTTCTTTCTCGAGAAAGAAGCTGAAGGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-140s1c1
Sequence:CCGGGATCGTGTTCTCCTGCATCTACTCGAGTAGATGCAGGAGAACACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004710.3-1065s21c1
Sequence:CCGGGCCGCTATTATCTGCGTTCTCCTCGAGGAGAACGCAGATAATAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004710.3-1008s21c1
Sequence:CCGGCCCATGTGCTACTGACAAGTGCTCGAGCACTTGTCAGTAGCACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004710.3-620s21c1
Sequence:CCGGCATCTGTGGACAACTACCAACCTCGAGGTTGGTAGTTGTCCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004710
SYNGR2 MISSION shRNA shRNA Plasmid DNA
synaptogyrin 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-555s1c1
Sequence:CCGGGACTTCATCCAGAATTACGTTCTCGAGAACGTAATTCTGGATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-190s1c1
Sequence:CCGGCTAAGCAGATGTACTGCGTGTCTCGAGACACGCAGTACATCTGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-377s1c1
Sequence:CCGGCTTCCTGTGGTTTGTTGGTTTCTCGAGAAACCAACAAACCACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-471s1c1
Sequence:CCGGGCCATCACCTTCAGCTTCTTTCTCGAGAAAGAAGCTGAAGGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-140s1c1
Sequence:CCGGGATCGTGTTCTCCTGCATCTACTCGAGTAGATGCAGGAGAACACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004710.3-1065s21c1
Sequence:CCGGGCCGCTATTATCTGCGTTCTCCTCGAGGAGAACGCAGATAATAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004710.3-1008s21c1
Sequence:CCGGCCCATGTGCTACTGACAAGTGCTCGAGCACTTGTCAGTAGCACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004710.3-620s21c1
Sequence:CCGGCATCTGTGGACAACTACCAACCTCGAGGTTGGTAGTTGTCCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004710
SYNGR2 MISSION shRNA Lentiviral Transduction Particles
synaptogyrin 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-555s1c1
Sequence:CCGGGACTTCATCCAGAATTACGTTCTCGAGAACGTAATTCTGGATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-190s1c1
Sequence:CCGGCTAAGCAGATGTACTGCGTGTCTCGAGACACGCAGTACATCTGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-377s1c1
Sequence:CCGGCTTCCTGTGGTTTGTTGGTTTCTCGAGAAACCAACAAACCACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-471s1c1
Sequence:CCGGGCCATCACCTTCAGCTTCTTTCTCGAGAAAGAAGCTGAAGGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004710.2-140s1c1
Sequence:CCGGGATCGTGTTCTCCTGCATCTACTCGAGTAGATGCAGGAGAACACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004710.3-1065s21c1
Sequence:CCGGGCCGCTATTATCTGCGTTCTCCTCGAGGAGAACGCAGATAATAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004710.3-1008s21c1
Sequence:CCGGCCCATGTGCTACTGACAAGTGCTCGAGCACTTGTCAGTAGCACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004710.3-620s21c1
Sequence:CCGGCATCTGTGGACAACTACCAACCTCGAGGTTGGTAGTTGTCCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009304
SYNGR2 MISSION shRNA Bacterial Glycerol Stock
synaptogyrin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009304.1-1368s1c1
Sequence:CCGGCCCAGCTTTATGTAAATACTACTCGAGTAGTATTTACATAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009304.1-175s1c1
Sequence:CCGGGCTACACCAACATTCACACATCTCGAGATGTGTGAATGTTGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009304.1-658s1c1
Sequence:CCGGTCACCCAGAATGTGGAGACTACTCGAGTAGTCTCCACATTCTGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009304.1-333s1c1
Sequence:CCGGGACCGAAAGTACCTGGTCATTCTCGAGAATGACCAGGTACTTTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009304.1-426s1c1
Sequence:CCGGGCAGCCACCAAACCTCAAGATCTCGAGATCTTGAGGTTTGGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009304.1-426s21c1
Sequence:CCGGGCAGCCACCAAACCTCAAGATCTCGAGATCTTGAGGTTTGGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009304.1-333s21c1
Sequence:CCGGGACCGAAAGTACCTGGTCATTCTCGAGAATGACCAGGTACTTTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009304.1-1368s21c1
Sequence:CCGGCCCAGCTTTATGTAAATACTACTCGAGTAGTATTTACATAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009304.1-175s21c1
Sequence:CCGGGCTACACCAACATTCACACATCTCGAGATGTGTGAATGTTGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009304
SYNGR2 MISSION shRNA shRNA Plasmid DNA
synaptogyrin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009304.1-1368s1c1
Sequence:CCGGCCCAGCTTTATGTAAATACTACTCGAGTAGTATTTACATAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009304.1-175s1c1
Sequence:CCGGGCTACACCAACATTCACACATCTCGAGATGTGTGAATGTTGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009304.1-658s1c1
Sequence:CCGGTCACCCAGAATGTGGAGACTACTCGAGTAGTCTCCACATTCTGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009304.1-333s1c1
Sequence:CCGGGACCGAAAGTACCTGGTCATTCTCGAGAATGACCAGGTACTTTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009304.1-426s1c1
Sequence:CCGGGCAGCCACCAAACCTCAAGATCTCGAGATCTTGAGGTTTGGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009304.1-426s21c1
Sequence:CCGGGCAGCCACCAAACCTCAAGATCTCGAGATCTTGAGGTTTGGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009304.1-333s21c1
Sequence:CCGGGACCGAAAGTACCTGGTCATTCTCGAGAATGACCAGGTACTTTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009304.1-1368s21c1
Sequence:CCGGCCCAGCTTTATGTAAATACTACTCGAGTAGTATTTACATAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009304.1-175s21c1
Sequence:CCGGGCTACACCAACATTCACACATCTCGAGATGTGTGAATGTTGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009304
SYNGR2 MISSION shRNA Lentiviral Transduction Particles
synaptogyrin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009304.1-1368s1c1
Sequence:CCGGCCCAGCTTTATGTAAATACTACTCGAGTAGTATTTACATAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009304.1-175s1c1
Sequence:CCGGGCTACACCAACATTCACACATCTCGAGATGTGTGAATGTTGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009304.1-658s1c1
Sequence:CCGGTCACCCAGAATGTGGAGACTACTCGAGTAGTCTCCACATTCTGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009304.1-333s1c1
Sequence:CCGGGACCGAAAGTACCTGGTCATTCTCGAGAATGACCAGGTACTTTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009304.1-426s1c1
Sequence:CCGGGCAGCCACCAAACCTCAAGATCTCGAGATCTTGAGGTTTGGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009304.1-426s21c1
Sequence:CCGGGCAGCCACCAAACCTCAAGATCTCGAGATCTTGAGGTTTGGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009304.1-333s21c1
Sequence:CCGGGACCGAAAGTACCTGGTCATTCTCGAGAATGACCAGGTACTTTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009304.1-1368s21c1
Sequence:CCGGCCCAGCTTTATGTAAATACTACTCGAGTAGTATTTACATAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009304.1-175s21c1
Sequence:CCGGGCTACACCAACATTCACACATCTCGAGATGTGTGAATGTTGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks