EMAIL THIS PAGE TO A FRIEND

SYNGR3

synaptogyrin 3

UniProtKB ID: O43761, B2R9S0
Gene ID:
Human(9143) Summary: This gene encodes an integral membrane protein. The exact function of this protein is unclear, but studies of a similar murine protein suggest that it is a synaptic vesicle protein that also interacts with the dopamine transporter. The gene product belongs to the synaptogyrin gene family. [provided by RefSeq, Dec 2010]
Mouse(20974) synaptogyrin 3
Rat(302975) synaptogyrin 3
chicken(416548) synaptogyrin 3
domestic cat(101083732) synaptogyrin 3
dog(490062) synaptogyrin 3
cow(618415) synaptogyrin 3
sheep(101113121) synaptogyrin 3
naked mole-rat(101720910) synaptogyrin 3
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004209 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004209 Rosetta Predictions human pricing
NM_001106985 Rosetta Predictions rat pricing
NM_011522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179550 predicted 801
2 SASI_Hs01_00179551 predicted 658
3 SASI_Hs01_00179552 predicted 924
4 SASI_Hs01_00179553 predicted 1264
5 SASI_Hs01_00179554 predicted 394
6 SASI_Hs01_00179555 predicted 1273
7 SASI_Hs01_00179557 predicted 396
8 SASI_Hs01_00179559 predicted 1065
9 SASI_Hs02_00337114 predicted 764
10 SASI_Hs02_00337115 predicted 1249
11 SASI_Hs01_00179556 predicted 232
12 SASI_Hs01_00179558 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106985 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224346 predicted 785
2 SASI_Rn02_00224347 predicted 760
3 SASI_Rn02_00224348 predicted 761
4 SASI_Rn02_00224349 predicted 509
5 SASI_Rn02_00224350 predicted 819
6 SASI_Rn02_00224351 predicted 922
7 SASI_Rn02_00224352 predicted 237
8 SASI_Rn02_00224353 predicted 244
9 SASI_Rn02_00224354 predicted 821
10 SASI_Rn02_00224355 predicted 911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153814 predicted 1086
2 SASI_Mm01_00153815 predicted 780
3 SASI_Mm01_00153816 predicted 1312
4 SASI_Mm01_00153817 predicted 912
5 SASI_Mm01_00153818 predicted 725
6 SASI_Mm01_00153819 predicted 807
7 SASI_Mm01_00153820 predicted 505
8 SASI_Mm01_00153821 predicted 721
9 SASI_Mm01_00153822 predicted 1001
10 SASI_Mm01_00153823 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004209
VALIDATED
SYNGR3 MISSION shRNA Bacterial Glycerol Stock
synaptogyrin 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004209.4-1803s21c1
Sequence:CCGGCCACATTTCATCAGACAGACACTCGAGTGTCTGTCTGATGAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004209.4-665s21c1
Sequence:CCGGATGTCACTCTTCGCCACCGAACTCGAGTTCGGTGGCGAAGAGTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004209.4-400s21c1
Sequence:CCGGCGATGTGCGCTTCCAGCAAATCTCGAGATTTGCTGGAAGCGCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004209.4-1874s21c1
Sequence:CCGGGACCAATTCTGTGTGGATATTCTCGAGAATATCCACACAGAATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004209.4-267s21c1
Sequence:CCGGTCAACGAGGGCTACGTGAACACTCGAGTGTTCACGTAGCCCTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1790s1c1
Sequence:CCGGCCAAACGTGGTTGCCACATTTCTCGAGAAATGTGGCAACCACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158271    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004209.4-1870s1c1
Sequence:CCGGCCTAGACCAATTCTGTGTGGACTCGAGTCCACACAGAATTGGTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1803s1c1
Sequence:CCGGCCACATTTCATCAGACAGACACTCGAGTGTCTGTCTGATGAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1874s1c1
Sequence:CCGGGACCAATTCTGTGTGGATATTCTCGAGAATATCCACACAGAATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1845s1c1
Sequence:CCGGGAGTGACAACCTTGTTACATTCTCGAGAATGTAACAAGGTTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1871s1c1
Sequence:CCGGCTAGACCAATTCTGTGTGGATCTCGAGATCCACACAGAATTGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004209
VALIDATED
SYNGR3 MISSION shRNA shRNA Plasmid DNA
synaptogyrin 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004209.4-1803s21c1
Sequence:CCGGCCACATTTCATCAGACAGACACTCGAGTGTCTGTCTGATGAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004209.4-665s21c1
Sequence:CCGGATGTCACTCTTCGCCACCGAACTCGAGTTCGGTGGCGAAGAGTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004209.4-400s21c1
Sequence:CCGGCGATGTGCGCTTCCAGCAAATCTCGAGATTTGCTGGAAGCGCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004209.4-1874s21c1
Sequence:CCGGGACCAATTCTGTGTGGATATTCTCGAGAATATCCACACAGAATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004209.4-267s21c1
Sequence:CCGGTCAACGAGGGCTACGTGAACACTCGAGTGTTCACGTAGCCCTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1790s1c1
Sequence:CCGGCCAAACGTGGTTGCCACATTTCTCGAGAAATGTGGCAACCACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158271    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004209.4-1870s1c1
Sequence:CCGGCCTAGACCAATTCTGTGTGGACTCGAGTCCACACAGAATTGGTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1803s1c1
Sequence:CCGGCCACATTTCATCAGACAGACACTCGAGTGTCTGTCTGATGAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1874s1c1
Sequence:CCGGGACCAATTCTGTGTGGATATTCTCGAGAATATCCACACAGAATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1845s1c1
Sequence:CCGGGAGTGACAACCTTGTTACATTCTCGAGAATGTAACAAGGTTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1871s1c1
Sequence:CCGGCTAGACCAATTCTGTGTGGATCTCGAGATCCACACAGAATTGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004209
VALIDATED
SYNGR3 MISSION shRNA Lentiviral Transduction Particles
synaptogyrin 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004209.4-1803s21c1
Sequence:CCGGCCACATTTCATCAGACAGACACTCGAGTGTCTGTCTGATGAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004209.4-665s21c1
Sequence:CCGGATGTCACTCTTCGCCACCGAACTCGAGTTCGGTGGCGAAGAGTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004209.4-400s21c1
Sequence:CCGGCGATGTGCGCTTCCAGCAAATCTCGAGATTTGCTGGAAGCGCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004209.4-1874s21c1
Sequence:CCGGGACCAATTCTGTGTGGATATTCTCGAGAATATCCACACAGAATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004209.4-267s21c1
Sequence:CCGGTCAACGAGGGCTACGTGAACACTCGAGTGTTCACGTAGCCCTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1790s1c1
Sequence:CCGGCCAAACGTGGTTGCCACATTTCTCGAGAAATGTGGCAACCACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158271    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004209.4-1870s1c1
Sequence:CCGGCCTAGACCAATTCTGTGTGGACTCGAGTCCACACAGAATTGGTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1803s1c1
Sequence:CCGGCCACATTTCATCAGACAGACACTCGAGTGTCTGTCTGATGAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1874s1c1
Sequence:CCGGGACCAATTCTGTGTGGATATTCTCGAGAATATCCACACAGAATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1845s1c1
Sequence:CCGGGAGTGACAACCTTGTTACATTCTCGAGAATGTAACAAGGTTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004209.4-1871s1c1
Sequence:CCGGCTAGACCAATTCTGTGTGGATCTCGAGATCCACACAGAATTGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011522
SYNGR3 MISSION shRNA Bacterial Glycerol Stock
synaptogyrin 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000093259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011522.2-1756s1c1
Sequence:CCGGCCTGTGGAGTTGCAGTTGAATCTCGAGATTCAACTGCAACTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011522.2-734s1c1
Sequence:CCGGTGTGGAGGGTACAGAAACATACTCGAGTATGTTTCTGTACCCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011522.2-650s1c1
Sequence:CCGGAGGCACCGATATGTCTCTCTTCTCGAGAAGAGAGACATATCGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011522.2-302s1c1
Sequence:CCGGGCGCTGCGTCTTCAACGGAAACTCGAGTTTCCGTTGAAGACGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011522
SYNGR3 MISSION shRNA shRNA Plasmid DNA
synaptogyrin 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000093259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011522.2-1756s1c1
Sequence:CCGGCCTGTGGAGTTGCAGTTGAATCTCGAGATTCAACTGCAACTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011522.2-734s1c1
Sequence:CCGGTGTGGAGGGTACAGAAACATACTCGAGTATGTTTCTGTACCCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011522.2-650s1c1
Sequence:CCGGAGGCACCGATATGTCTCTCTTCTCGAGAAGAGAGACATATCGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011522.2-302s1c1
Sequence:CCGGGCGCTGCGTCTTCAACGGAAACTCGAGTTTCCGTTGAAGACGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011522
SYNGR3 MISSION shRNA Lentiviral Transduction Particles
synaptogyrin 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000093259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011522.2-1756s1c1
Sequence:CCGGCCTGTGGAGTTGCAGTTGAATCTCGAGATTCAACTGCAACTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011522.2-734s1c1
Sequence:CCGGTGTGGAGGGTACAGAAACATACTCGAGTATGTTTCTGTACCCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011522.2-650s1c1
Sequence:CCGGAGGCACCGATATGTCTCTCTTCTCGAGAAGAGAGACATATCGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011522.2-302s1c1
Sequence:CCGGGCGCTGCGTCTTCAACGGAAACTCGAGTTTCCGTTGAAGACGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks