EMAIL THIS PAGE TO A FRIEND

SYNGR4

synaptogyrin 4

UniProtKB ID: O95473, Q3KP58
Gene ID:
Human(23546) Summary: This gene encodes an integral membrane protein. The gene belongs to the synaptogyrin gene family. Like other members of the family the protein contains four transmembrane regions. The exact function of this protein is unclear. [provided by RefSeq, Jul 2008]
Mouse(58867) synaptogyrin 4
Rat(292916) synaptogyrin 4
domestic cat(101088705) synaptogyrin 4
dog(612063) synaptogyrin 4
naked mole-rat(101697459) synaptogyrin 4
cow(538683) synaptogyrin 4
sheep(101121794) synaptogyrin 4
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021482 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021482 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021482 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012451 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006801 MISSION® esiRNA esiRNA targeting human SYNGR4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012451 Rosetta Predictions human pricing
NM_001025644 Rosetta Predictions rat pricing
NM_021482 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241356 predicted 271
2 SASI_Hs01_00241357 predicted 512
3 SASI_Hs01_00241358 predicted 676
4 SASI_Hs01_00241359 predicted 621
5 SASI_Hs01_00241360 predicted 515
6 SASI_Hs01_00241361 predicted 291
7 SASI_Hs01_00241362 predicted 309
8 SASI_Hs01_00241363 predicted 768
9 SASI_Hs01_00241364 predicted 542
10 SASI_Hs02_00344359 predicted 338
11 SASI_Hs01_00241365 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074446 predicted 1253
2 SASI_Rn01_00074447 predicted 256
3 SASI_Rn01_00074448 predicted 254
4 SASI_Rn01_00074450 predicted 605
5 SASI_Rn01_00074451 predicted 336
6 SASI_Rn01_00074452 predicted 1324
7 SASI_Rn01_00074453 predicted 919
8 SASI_Rn01_00074454 predicted 492
9 SASI_Rn01_00074455 predicted 491
10 SASI_Rn02_00203218 predicted 257
11 SASI_Rn01_00074449 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104640 predicted 442
2 SASI_Mm02_00326166 predicted 599
3 SASI_Mm02_00326167 predicted 247
4 SASI_Mm02_00326168 predicted 392
5 SASI_Mm02_00326169 predicted 512
6 SASI_Mm02_00326170 predicted 257
7 SASI_Mm02_00326171 predicted 244
8 SASI_Mm02_00326172 predicted 330
9 SASI_Mm02_00326173 predicted 553
10 SASI_Mm02_00326174 predicted 361
11 SASI_Mm01_00104632 predicted 238
12 SASI_Mm01_00104633 predicted 248
13 SASI_Mm01_00104634 predicted 237
14 SASI_Mm01_00104635 predicted 199
15 SASI_Mm01_00104636 predicted 242
16 SASI_Mm01_00104637 predicted 235
17 SASI_Mm01_00104638 predicted 234
18 SASI_Mm01_00104639 predicted 196
19 SASI_Mm01_00104641 predicted 815
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021482
SYNGR4 MISSION shRNA Bacterial Glycerol Stock
synaptogyrin 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000093524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021482.1-251s1c1
Sequence:CCGGCCTCTCTACTAACTGATGGTTCTCGAGAACCATCAGTTAGTAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021482.1-384s1c1
Sequence:CCGGCCTTGCCATAGATGCCTATGACTCGAGTCATAGGCATCTATGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021482.1-169s1c1
Sequence:CCGGGACAATGAGACTGTGCGCTTTCTCGAGAAAGCGCACAGTCTCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021482.1-420s1c1
Sequence:CCGGCACCCGCTTTAAGATAGCCTTCTCGAGAAGGCTATCTTAAAGCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021482
SYNGR4 MISSION shRNA shRNA Plasmid DNA
synaptogyrin 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000093524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021482.1-251s1c1
Sequence:CCGGCCTCTCTACTAACTGATGGTTCTCGAGAACCATCAGTTAGTAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021482.1-384s1c1
Sequence:CCGGCCTTGCCATAGATGCCTATGACTCGAGTCATAGGCATCTATGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021482.1-169s1c1
Sequence:CCGGGACAATGAGACTGTGCGCTTTCTCGAGAAAGCGCACAGTCTCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021482.1-420s1c1
Sequence:CCGGCACCCGCTTTAAGATAGCCTTCTCGAGAAGGCTATCTTAAAGCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021482
SYNGR4 MISSION shRNA Lentiviral Transduction Particles
synaptogyrin 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000093524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021482.1-251s1c1
Sequence:CCGGCCTCTCTACTAACTGATGGTTCTCGAGAACCATCAGTTAGTAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021482.1-384s1c1
Sequence:CCGGCCTTGCCATAGATGCCTATGACTCGAGTCATAGGCATCTATGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021482.1-169s1c1
Sequence:CCGGGACAATGAGACTGTGCGCTTTCTCGAGAAAGCGCACAGTCTCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021482.1-420s1c1
Sequence:CCGGCACCCGCTTTAAGATAGCCTTCTCGAGAAGGCTATCTTAAAGCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012451
SYNGR4 MISSION shRNA Bacterial Glycerol Stock
synaptogyrin 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000203729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012451.2-704s1c1
Sequence:CCGGCATCCTTGTCTGGATATTCCACTCGAGTGGAATATCCAGACAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012451.2-751s1c1
Sequence:CCGGGAAATGATGCTCCAGTCCCTTCTCGAGAAGGGACTGGAGCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012451.2-701s1c1
Sequence:CCGGCTCCATCCTTGTCTGGATATTCTCGAGAATATCCAGACAAGGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012451.2-410s1c1
Sequence:CCGGCCACTGCATTCTCAACAGCAACTCGAGTTGCTGTTGAGAATGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012451
SYNGR4 MISSION shRNA shRNA Plasmid DNA
synaptogyrin 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000203729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012451.2-704s1c1
Sequence:CCGGCATCCTTGTCTGGATATTCCACTCGAGTGGAATATCCAGACAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012451.2-751s1c1
Sequence:CCGGGAAATGATGCTCCAGTCCCTTCTCGAGAAGGGACTGGAGCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012451.2-701s1c1
Sequence:CCGGCTCCATCCTTGTCTGGATATTCTCGAGAATATCCAGACAAGGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012451.2-410s1c1
Sequence:CCGGCCACTGCATTCTCAACAGCAACTCGAGTTGCTGTTGAGAATGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012451
SYNGR4 MISSION shRNA Lentiviral Transduction Particles
synaptogyrin 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000203729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012451.2-704s1c1
Sequence:CCGGCATCCTTGTCTGGATATTCCACTCGAGTGGAATATCCAGACAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012451.2-751s1c1
Sequence:CCGGGAAATGATGCTCCAGTCCCTTCTCGAGAAGGGACTGGAGCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012451.2-701s1c1
Sequence:CCGGCTCCATCCTTGTCTGGATATTCTCGAGAATATCCAGACAAGGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012451.2-410s1c1
Sequence:CCGGCCACTGCATTCTCAACAGCAACTCGAGTTGCTGTTGAGAATGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks