EMAIL THIS PAGE TO A FRIEND

SYNJ1

synaptojanin 1

Synonyms: INPP5G
UniProtKB ID: O43426, O43425, O94984, Q4KMR1
Gene ID:
Human(8867) Summary: This gene encodes a phosphoinositide phosphatase that regulates levels of membrane phosphatidylinositol-4,5-bisphosphate. As such, expression of this enzyme may affect synaptic transmission and membrane trafficking. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(104015) synaptojanin 1
Rat(85238) synaptojanin 1
Zebrafish(337236) synaptojanin 1
chicken(418498) synaptojanin 1
dog(478403) synaptojanin 1
Horse(100052605) synaptojanin 1
domestic cat(101090793) synaptojanin 1
cow(282087) synaptojanin 1
sheep(101101853) synaptojanin 1
naked mole-rat(101718278) synaptojanin 1
216 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003895 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_358889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU085901 MISSION® esiRNA esiRNA targeting mouse Synj1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003895 Rosetta Predictions human pricing
NM_203446 Rosetta Predictions human pricing
XM_001073290 Rosetta Predictions rat pricing
XM_573256 Rosetta Predictions rat pricing
XM_001481287 Rosetta Predictions mouse pricing
XM_358889 Rosetta Predictions mouse pricing
XM_973263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336514 predicted 1554
2 SASI_Hs01_00045702 predicted 241
3 SASI_Hs01_00045703 predicted 2720
4 SASI_Hs01_00045705 predicted 329
5 SASI_Hs01_00045707 predicted 343
6 SASI_Hs01_00045708 predicted 227
7 SASI_Hs01_00045709 predicted 1678
8 SASI_Hs02_00336515 predicted 4591
9 SASI_Hs02_00336516 predicted 2626
10 SASI_Hs01_00045710 predicted 2372
11 SASI_Hs01_00045704 predicted 496
12 SASI_Hs01_00045706 predicted 258
13 SASI_Hs01_00045711 predicted 1422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373375 predicted 1620
2 SASI_Hs01_00148775 predicted 301
3 SASI_Hs01_00148776 predicted 2790
4 SASI_Hs01_00148778 predicted 397
5 SASI_Hs01_00148780 predicted 407
6 SASI_Hs02_00373376 predicted 895
7 SASI_Hs01_00148781 predicted 288
8 SASI_Hs01_00148782 predicted 1740
9 SASI_Hs02_00373377 predicted 2698
10 SASI_Hs01_00148784 predicted 2434
11 SASI_Hs01_00148777 predicted 569
12 SASI_Hs01_00148779 predicted 323
13 SASI_Hs01_00148783 predicted 1254
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342255 predicted 2771
2 SASI_Rn02_00342256 predicted 2677
3 SASI_Rn02_00342257 predicted 1410
4 SASI_Rn02_00342258 predicted 2096
5 SASI_Rn02_00342259 predicted 1738
6 SASI_Rn02_00342260 predicted 208
7 SASI_Rn02_00342261 predicted 282
8 SASI_Rn02_00342262 predicted 2864
9 SASI_Rn02_00342263 predicted 2591
10 SASI_Rn02_00342264 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400064 predicted 1645
2 SASI_Rn02_00400065 predicted 2324
3 SASI_Rn02_00400066 predicted 4497
4 SASI_Rn02_00400067 predicted 1971
5 SASI_Rn02_00400068 predicted 440
6 SASI_Rn02_00400069 predicted 389
7 SASI_Rn02_00400070 predicted 524
8 SASI_Rn02_00400071 predicted 1115
9 SASI_Rn02_00400072 predicted 567
10 SASI_Rn02_00400073 predicted 1607
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423414 predicted 1568
2 SASI_Mm02_00423415 predicted 3202
3 SASI_Mm02_00423416 predicted 775
4 SASI_Mm02_00423417 predicted 3452
5 SASI_Mm02_00423418 predicted 4923
6 SASI_Mm02_00423419 predicted 995
7 SASI_Mm02_00423420 predicted 1994
8 SASI_Mm02_00423421 predicted 452
9 SASI_Mm02_00423422 predicted 1813
10 SASI_Mm02_00423423 predicted 2155
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250525 predicted 1565
2 SASI_Mm01_00250526 predicted 3208
3 SASI_Mm01_00250527 predicted 773
4 SASI_Mm01_00250528 predicted 4898
5 SASI_Mm01_00250529 predicted 1002
6 SASI_Mm01_00250530 predicted 453
7 SASI_Mm01_00250531 predicted 4065
8 SASI_Mm01_00250532 predicted 1826
9 SASI_Mm01_00250533 predicted 493
10 SASI_Mm01_00250534 predicted 2157
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444895 predicted 1561
2 SASI_Mm02_00444896 predicted 3202
3 SASI_Mm02_00444897 predicted 767
4 SASI_Mm02_00444898 predicted 3457
5 SASI_Mm02_00444899 predicted 4924
6 SASI_Mm02_00444900 predicted 996
7 SASI_Mm02_00444901 predicted 1990
8 SASI_Mm02_00444902 predicted 446
9 SASI_Mm02_00444903 predicted 1822
10 SASI_Mm02_00444904 predicted 2151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003895
VALIDATED
SYNJ1 MISSION shRNA Bacterial Glycerol Stock
synaptojanin 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003895.3-2449s21c1
Sequence:GTACCGGGTAACCTTTGCTCCGACATATCTCGAGATATGTCGGAGCAAAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003895.2-4117s21c1
Sequence:CCGGGCCTTCTGCAACGCAAAGTAACTCGAGTTACTTTGCGTTGCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003895.2-331s21c1
Sequence:CCGGCCGAGTTACTTCCACTGAGTTCTCGAGAACTCAGTGGAAGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003895.2-2886s21c1
Sequence:CCGGCCTTGAATGTTCTGAGCCTAACTCGAGTTAGGCTCAGAACATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003895.2-4817s21c1
Sequence:CCGGGAGAATTGGGCATTAGTATTTCTCGAGAAATACTAATGCCCAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003895.2-2309s21c1
Sequence:CCGGGCAGGAGATCAACTTATCAATCTCGAGATTGATAAGTTGATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003895.2-4345s1c1
Sequence:CCGGGCCCGTTACTATCAGTCCTTTCTCGAGAAAGGACTGATAGTAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003895.2-331s1c1
Sequence:CCGGCCGAGTTACTTCCACTGAGTTCTCGAGAACTCAGTGGAAGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003895.2-2309s1c1
Sequence:CCGGGCAGGAGATCAACTTATCAATCTCGAGATTGATAAGTTGATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003895.2-4117s1c1
Sequence:CCGGGCCTTCTGCAACGCAAAGTAACTCGAGTTACTTTGCGTTGCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003895.2-2886s1c1
Sequence:CCGGCCTTGAATGTTCTGAGCCTAACTCGAGTTAGGCTCAGAACATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003895
VALIDATED
SYNJ1 MISSION shRNA shRNA Plasmid DNA
synaptojanin 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003895.3-2449s21c1
Sequence:GTACCGGGTAACCTTTGCTCCGACATATCTCGAGATATGTCGGAGCAAAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003895.2-4117s21c1
Sequence:CCGGGCCTTCTGCAACGCAAAGTAACTCGAGTTACTTTGCGTTGCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003895.2-331s21c1
Sequence:CCGGCCGAGTTACTTCCACTGAGTTCTCGAGAACTCAGTGGAAGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003895.2-2886s21c1
Sequence:CCGGCCTTGAATGTTCTGAGCCTAACTCGAGTTAGGCTCAGAACATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003895.2-4817s21c1
Sequence:CCGGGAGAATTGGGCATTAGTATTTCTCGAGAAATACTAATGCCCAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003895.2-2309s21c1
Sequence:CCGGGCAGGAGATCAACTTATCAATCTCGAGATTGATAAGTTGATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003895.2-4345s1c1
Sequence:CCGGGCCCGTTACTATCAGTCCTTTCTCGAGAAAGGACTGATAGTAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003895.2-331s1c1
Sequence:CCGGCCGAGTTACTTCCACTGAGTTCTCGAGAACTCAGTGGAAGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003895.2-2309s1c1
Sequence:CCGGGCAGGAGATCAACTTATCAATCTCGAGATTGATAAGTTGATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003895.2-4117s1c1
Sequence:CCGGGCCTTCTGCAACGCAAAGTAACTCGAGTTACTTTGCGTTGCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003895.2-2886s1c1
Sequence:CCGGCCTTGAATGTTCTGAGCCTAACTCGAGTTAGGCTCAGAACATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003895
VALIDATED
SYNJ1 MISSION shRNA Lentiviral Transduction Particles
synaptojanin 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003895.3-2449s21c1
Sequence:GTACCGGGTAACCTTTGCTCCGACATATCTCGAGATATGTCGGAGCAAAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003895.2-4117s21c1
Sequence:CCGGGCCTTCTGCAACGCAAAGTAACTCGAGTTACTTTGCGTTGCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003895.2-331s21c1
Sequence:CCGGCCGAGTTACTTCCACTGAGTTCTCGAGAACTCAGTGGAAGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003895.2-2886s21c1
Sequence:CCGGCCTTGAATGTTCTGAGCCTAACTCGAGTTAGGCTCAGAACATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003895.2-4817s21c1
Sequence:CCGGGAGAATTGGGCATTAGTATTTCTCGAGAAATACTAATGCCCAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003895.2-2309s21c1
Sequence:CCGGGCAGGAGATCAACTTATCAATCTCGAGATTGATAAGTTGATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003895.2-4345s1c1
Sequence:CCGGGCCCGTTACTATCAGTCCTTTCTCGAGAAAGGACTGATAGTAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003895.2-331s1c1
Sequence:CCGGCCGAGTTACTTCCACTGAGTTCTCGAGAACTCAGTGGAAGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003895.2-2309s1c1
Sequence:CCGGGCAGGAGATCAACTTATCAATCTCGAGATTGATAAGTTGATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003895.2-4117s1c1
Sequence:CCGGGCCTTCTGCAACGCAAAGTAACTCGAGTTACTTTGCGTTGCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003895.2-2886s1c1
Sequence:CCGGCCTTGAATGTTCTGAGCCTAACTCGAGTTAGGCTCAGAACATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358889
VALIDATED
SYNJ1 MISSION shRNA Bacterial Glycerol Stock
synaptojanin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358889.3-1925s1c1
Sequence:CCGGCGCTTCTAACTACTGGAAGTTCTCGAGAACTTCCAGTAGTTAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358889.3-3007s1c1
Sequence:CCGGGCCTTGATTGACATAGATATACTCGAGTATATCTATGTCAATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358889.3-1598s1c1
Sequence:CCGGGAACAAATAGTGTGCAGGCATCTCGAGATGCCTGCACACTATTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358889.3-571s1c1
Sequence:CCGGGAGGCTATTAAAGGCACATATCTCGAGATATGTGCCTTTAATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358889.3-1229s1c1
Sequence:CCGGCCCATCGTGTTCGTATGTCAACTCGAGTTGACATACGAACACGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358889
VALIDATED
SYNJ1 MISSION shRNA shRNA Plasmid DNA
synaptojanin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358889.3-1925s1c1
Sequence:CCGGCGCTTCTAACTACTGGAAGTTCTCGAGAACTTCCAGTAGTTAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358889.3-3007s1c1
Sequence:CCGGGCCTTGATTGACATAGATATACTCGAGTATATCTATGTCAATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358889.3-1598s1c1
Sequence:CCGGGAACAAATAGTGTGCAGGCATCTCGAGATGCCTGCACACTATTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358889.3-571s1c1
Sequence:CCGGGAGGCTATTAAAGGCACATATCTCGAGATATGTGCCTTTAATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358889.3-1229s1c1
Sequence:CCGGCCCATCGTGTTCGTATGTCAACTCGAGTTGACATACGAACACGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358889
VALIDATED
SYNJ1 MISSION shRNA Lentiviral Transduction Particles
synaptojanin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358889.3-1925s1c1
Sequence:CCGGCGCTTCTAACTACTGGAAGTTCTCGAGAACTTCCAGTAGTTAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358889.3-3007s1c1
Sequence:CCGGGCCTTGATTGACATAGATATACTCGAGTATATCTATGTCAATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358889.3-1598s1c1
Sequence:CCGGGAACAAATAGTGTGCAGGCATCTCGAGATGCCTGCACACTATTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358889.3-571s1c1
Sequence:CCGGGAGGCTATTAAAGGCACATATCTCGAGATATGTGCCTTTAATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358889.3-1229s1c1
Sequence:CCGGCCCATCGTGTTCGTATGTCAACTCGAGTTGACATACGAACACGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks