EMAIL THIS PAGE TO A FRIEND

SYNJ2

synaptojanin 2

Synonyms: INPP5H
Gene ID:
Human(8871) Summary: The gene is a member of the inositol-polyphosphate 5-phosphatase family. The encoded protein interacts with the ras-related C3 botulinum toxin substrate 1, which causes translocation of the encoded protein to the plasma membrane where it inhibits clathrin-mediated endocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(20975) synaptojanin 2
Rat(84018) synaptojanin 2
naked mole-rat(101700219) synaptojanin 2
cow(518435) synaptojanin 2
sheep(101109366) synaptojanin 2
chicken(421656) synaptojanin 2
Horse(100059716) synaptojanin 2
domestic cat(101087233) synaptojanin 2
dog(484052) synaptojanin 2
178 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003898 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062081 MISSION® esiRNA esiRNA human SYNJ2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003898 Rosetta Predictions human pricing
NM_001113371 Rosetta Predictions rat pricing
NM_001113372 Rosetta Predictions rat pricing
NM_032071 Rosetta Predictions rat pricing
NM_001113351 Rosetta Predictions mouse pricing
NM_001113352 Rosetta Predictions mouse pricing
NM_001113353 Rosetta Predictions mouse pricing
NM_011523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068769 predicted 1915
2 SASI_Hs01_00068770 predicted 3123
3 SASI_Hs01_00068771 predicted 2535
4 SASI_Hs01_00068772 predicted 4329
5 SASI_Hs01_00068773 predicted 2241
6 SASI_Hs01_00068774 predicted 472
7 SASI_Hs01_00068775 predicted 2345
8 SASI_Hs01_00068776 predicted 2385
9 SASI_Hs02_00336522 predicted 1208
10 SASI_Hs01_00068777 predicted 2614
11 SASI_Hs01_00068778 predicted 4535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251783 predicted 1379
2 SASI_Rn02_00251784 predicted 1179
3 SASI_Rn02_00251785 predicted 1086
4 SASI_Rn02_00251786 predicted 1469
5 SASI_Rn02_00251787 predicted 523
6 SASI_Rn02_00251788 predicted 2803
7 SASI_Rn02_00251789 predicted 2505
8 SASI_Rn02_00251790 predicted 2241
9 SASI_Rn02_00251791 predicted 2720
10 SASI_Rn02_00251792 predicted 2468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251793 predicted 1378
2 SASI_Rn02_00251794 predicted 1175
3 SASI_Rn02_00251795 predicted 1090
4 SASI_Rn02_00251796 predicted 1469
5 SASI_Rn02_00251797 predicted 523
6 SASI_Rn02_00251798 predicted 2809
7 SASI_Rn02_00251799 predicted 2510
8 SASI_Rn02_00251800 predicted 2235
9 SASI_Rn02_00251801 predicted 2714
10 SASI_Rn02_00251802 predicted 2471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092363 predicted 1430
2 SASI_Rn02_00265429 predicted 1235
3 SASI_Rn01_00092364 predicted 1148
4 SASI_Rn01_00092365 predicted 1526
5 SASI_Rn02_00265430 predicted 576
6 SASI_Rn01_00092366 predicted 2859
7 SASI_Rn01_00092368 predicted 2561
8 SASI_Rn01_00092369 predicted 2290
9 SASI_Rn02_00265431 predicted 987
10 SASI_Rn01_00092371 predicted 2767
11 SASI_Rn01_00092367 predicted 3169
12 SASI_Rn01_00092370 predicted 3089
13 SASI_Rn01_00092372 predicted 2533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307433 predicted 2832
2 SASI_Mm02_00307434 predicted 2252
3 SASI_Mm02_00307435 predicted 479
4 SASI_Mm02_00307436 predicted 1192
5 SASI_Mm02_00307437 predicted 2270
6 SASI_Mm02_00307438 predicted 1699
7 SASI_Mm02_00307439 predicted 2675
8 SASI_Mm02_00307440 predicted 1012
9 SASI_Mm02_00307441 predicted 1141
10 SASI_Mm02_00307442 predicted 1639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307443 predicted 2926
2 SASI_Mm02_00307444 predicted 2337
3 SASI_Mm02_00307445 predicted 569
4 SASI_Mm02_00307446 predicted 1281
5 SASI_Mm02_00307447 predicted 2353
6 SASI_Mm02_00307448 predicted 1791
7 SASI_Mm02_00307449 predicted 2757
8 SASI_Mm02_00307450 predicted 1101
9 SASI_Mm02_00307451 predicted 1234
10 SASI_Mm02_00307452 predicted 1727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307453 predicted 2922
2 SASI_Mm02_00307454 predicted 2342
3 SASI_Mm02_00307455 predicted 567
4 SASI_Mm02_00307456 predicted 1282
5 SASI_Mm02_00307457 predicted 2357
6 SASI_Mm02_00307458 predicted 1790
7 SASI_Mm02_00307459 predicted 2762
8 SASI_Mm02_00307460 predicted 1100
9 SASI_Mm02_00307461 predicted 1234
10 SASI_Mm02_00307462 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104299 predicted 2838
2 SASI_Mm01_00104300 predicted 2253
3 SASI_Mm02_00320840 predicted 481
4 SASI_Mm02_00320841 predicted 1189
5 SASI_Mm01_00104301 predicted 2265
6 SASI_Mm02_00320842 predicted 1699
7 SASI_Mm01_00104303 predicted 2675
8 SASI_Mm02_00320843 predicted 1017
9 SASI_Mm02_00320844 predicted 1142
10 SASI_Mm02_00320845 predicted 1644
11 SASI_Mm01_00104302 predicted 3011
12 SASI_Mm01_00104304 predicted 3090
13 SASI_Mm01_00104305 predicted 3627
14 SASI_Mm01_00104306 predicted 2279
15 SASI_Mm01_00104307 predicted 1178
16 SASI_Mm01_00104308 predicted 1122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003898
VALIDATED
SYNJ2 MISSION shRNA Bacterial Glycerol Stock
synaptojanin 2
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-2446s1c1
Sequence:CCGGCCTACGATACAAGCGACAAATCTCGAGATTTGTCGCTTGTATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-3837s1c1
Sequence:CCGGCCGGAAGAACAGTTTGAGCAACTCGAGTTGCTCAAACTGTTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-225s1c1
Sequence:CCGGGAAGTCATTAAAGGACAGTATCTCGAGATACTGTCCTTTAATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-2415s1c1
Sequence:CCGGCCCACCTACAAGTATGACGTTCTCGAGAACGTCATACTTGTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-3006s1c1
Sequence:CCGGCGAGAGGAGATCATTCGGAAACTCGAGTTTCCGAATGATCTCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-3263s21c1
Sequence:GTACCGGAGCAGCATCCAACGTACAAAGCTCGAGCTTTGTACGTTGGATGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1843s21c1
Sequence:CCGGGAATTGAGCGCAGGGAATATTCTCGAGAATATTCCCTGCGCTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003898.2-5014s21c1
Sequence:CCGGGAGGTCGTTGTGACCATTAATCTCGAGATTAATGGTCACAACGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-2260s21c1
Sequence:CCGGTACCGCATTGATCTTACTTATCTCGAGATAAGTAAGATCAATGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003898.2-6265s21c1
Sequence:CCGGCAAGATGCACATCGCTATTAACTCGAGTTAATAGCGATGTGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_003898.2-2739s21c1
Sequence:CCGGGGATGCCACTGTTGTAGTAAACTCGAGTTTACTACAACAGTGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-2438s21c1
Sequence:CCGGCCTACGATACAAGCGACAAATCTCGAGATTTGTCGCTTGTATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1922s21c1
Sequence:CCGGCACGCTCTCATAGATACATTCCTCGAGGAATGTATCTATGAGAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1058s21c1
Sequence:CCGGGCGACACGCCTATGATCAATTCTCGAGAATTGATCATAGGCGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003898.2-4806s21c1
Sequence:CCGGTCCTGTTAAATTCGGTGTATGCTCGAGCATACACCGAATTTAACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-3538s21c1
Sequence:CCGGGCTCGGACTGGAATAAGTAAACTCGAGTTTACTTATTCCAGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1967s21c1
Sequence:CCGGGCGTCTGTCTTTATATCTTTGCTCGAGCAAAGATATAAAGACAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1129s21c1
Sequence:CCGGCTCTTGAGGCCACAGTTAAAGCTCGAGCTTTAACTGTGGCCTCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-2402s21c1
Sequence:CCGGTTGGACCCACCTACAAGTATGCTCGAGCATACTTGTAGGTGGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003898
VALIDATED
SYNJ2 MISSION shRNA shRNA Plasmid DNA
synaptojanin 2
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-2446s1c1
Sequence:CCGGCCTACGATACAAGCGACAAATCTCGAGATTTGTCGCTTGTATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-3837s1c1
Sequence:CCGGCCGGAAGAACAGTTTGAGCAACTCGAGTTGCTCAAACTGTTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-225s1c1
Sequence:CCGGGAAGTCATTAAAGGACAGTATCTCGAGATACTGTCCTTTAATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-2415s1c1
Sequence:CCGGCCCACCTACAAGTATGACGTTCTCGAGAACGTCATACTTGTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-3006s1c1
Sequence:CCGGCGAGAGGAGATCATTCGGAAACTCGAGTTTCCGAATGATCTCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-3263s21c1
Sequence:GTACCGGAGCAGCATCCAACGTACAAAGCTCGAGCTTTGTACGTTGGATGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1843s21c1
Sequence:CCGGGAATTGAGCGCAGGGAATATTCTCGAGAATATTCCCTGCGCTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003898.2-5014s21c1
Sequence:CCGGGAGGTCGTTGTGACCATTAATCTCGAGATTAATGGTCACAACGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-2260s21c1
Sequence:CCGGTACCGCATTGATCTTACTTATCTCGAGATAAGTAAGATCAATGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003898.2-6265s21c1
Sequence:CCGGCAAGATGCACATCGCTATTAACTCGAGTTAATAGCGATGTGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_003898.2-2739s21c1
Sequence:CCGGGGATGCCACTGTTGTAGTAAACTCGAGTTTACTACAACAGTGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-2438s21c1
Sequence:CCGGCCTACGATACAAGCGACAAATCTCGAGATTTGTCGCTTGTATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1922s21c1
Sequence:CCGGCACGCTCTCATAGATACATTCCTCGAGGAATGTATCTATGAGAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1058s21c1
Sequence:CCGGGCGACACGCCTATGATCAATTCTCGAGAATTGATCATAGGCGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003898.2-4806s21c1
Sequence:CCGGTCCTGTTAAATTCGGTGTATGCTCGAGCATACACCGAATTTAACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-3538s21c1
Sequence:CCGGGCTCGGACTGGAATAAGTAAACTCGAGTTTACTTATTCCAGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1967s21c1
Sequence:CCGGGCGTCTGTCTTTATATCTTTGCTCGAGCAAAGATATAAAGACAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1129s21c1
Sequence:CCGGCTCTTGAGGCCACAGTTAAAGCTCGAGCTTTAACTGTGGCCTCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-2402s21c1
Sequence:CCGGTTGGACCCACCTACAAGTATGCTCGAGCATACTTGTAGGTGGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003898
VALIDATED
SYNJ2 MISSION shRNA Lentiviral Transduction Particles
synaptojanin 2
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-2446s1c1
Sequence:CCGGCCTACGATACAAGCGACAAATCTCGAGATTTGTCGCTTGTATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-3837s1c1
Sequence:CCGGCCGGAAGAACAGTTTGAGCAACTCGAGTTGCTCAAACTGTTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-225s1c1
Sequence:CCGGGAAGTCATTAAAGGACAGTATCTCGAGATACTGTCCTTTAATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-2415s1c1
Sequence:CCGGCCCACCTACAAGTATGACGTTCTCGAGAACGTCATACTTGTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003898.1-3006s1c1
Sequence:CCGGCGAGAGGAGATCATTCGGAAACTCGAGTTTCCGAATGATCTCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-3263s21c1
Sequence:GTACCGGAGCAGCATCCAACGTACAAAGCTCGAGCTTTGTACGTTGGATGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1843s21c1
Sequence:CCGGGAATTGAGCGCAGGGAATATTCTCGAGAATATTCCCTGCGCTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003898.2-5014s21c1
Sequence:CCGGGAGGTCGTTGTGACCATTAATCTCGAGATTAATGGTCACAACGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-2260s21c1
Sequence:CCGGTACCGCATTGATCTTACTTATCTCGAGATAAGTAAGATCAATGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003898.2-6265s21c1
Sequence:CCGGCAAGATGCACATCGCTATTAACTCGAGTTAATAGCGATGTGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_003898.2-2739s21c1
Sequence:CCGGGGATGCCACTGTTGTAGTAAACTCGAGTTTACTACAACAGTGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-2438s21c1
Sequence:CCGGCCTACGATACAAGCGACAAATCTCGAGATTTGTCGCTTGTATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1922s21c1
Sequence:CCGGCACGCTCTCATAGATACATTCCTCGAGGAATGTATCTATGAGAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1058s21c1
Sequence:CCGGGCGACACGCCTATGATCAATTCTCGAGAATTGATCATAGGCGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003898.2-4806s21c1
Sequence:CCGGTCCTGTTAAATTCGGTGTATGCTCGAGCATACACCGAATTTAACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-3538s21c1
Sequence:CCGGGCTCGGACTGGAATAAGTAAACTCGAGTTTACTTATTCCAGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1967s21c1
Sequence:CCGGGCGTCTGTCTTTATATCTTTGCTCGAGCAAAGATATAAAGACAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-1129s21c1
Sequence:CCGGCTCTTGAGGCCACAGTTAAAGCTCGAGCTTTAACTGTGGCCTCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003898.2-2402s21c1
Sequence:CCGGTTGGACCCACCTACAAGTATGCTCGAGCATACTTGTAGGTGGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011523
VALIDATED
SYNJ2 MISSION shRNA Bacterial Glycerol Stock
synaptojanin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011523.1-3935s1c1
Sequence:CCGGCTGTAGAGTACGTTGGTACAACTCGAGTTGTACCAACGTACTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011523.1-2762s1c1
Sequence:CCGGGCACAGAACTTATGCAGACTTCTCGAGAAGTCTGCATAAGTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011523.1-3479s1c1
Sequence:CCGGCCAAGGCTAGAACTGGAATAACTCGAGTTATTCCAGTTCTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011523.1-1266s1c1
Sequence:CCGGGCTAAATTCAAAGCCCATCATCTCGAGATGATGGGCTTTGAATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011523.1-1007s1c1
Sequence:CCGGCGGGTGACACACCTATGATAACTCGAGTTATCATAGGTGTGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011523.2-3990s21c1
Sequence:CCGGCTGTAGAGTACGTTGGTACAACTCGAGTTGTACCAACGTACTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011523.2-1062s21c1
Sequence:CCGGCGGGTGACACACCTATGATAACTCGAGTTATCATAGGTGTGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011523.2-2817s21c1
Sequence:CCGGGCACAGAACTTATGCAGACTTCTCGAGAAGTCTGCATAAGTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011523.2-2840s21c1
Sequence:CCGGGGGAATTATGGGACGATTATTCTCGAGAATAATCGTCCCATAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011523.2-3534s21c1
Sequence:CCGGCCAAGGCTAGAACTGGAATAACTCGAGTTATTCCAGTTCTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011523
VALIDATED
SYNJ2 MISSION shRNA shRNA Plasmid DNA
synaptojanin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011523.1-3935s1c1
Sequence:CCGGCTGTAGAGTACGTTGGTACAACTCGAGTTGTACCAACGTACTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011523.1-2762s1c1
Sequence:CCGGGCACAGAACTTATGCAGACTTCTCGAGAAGTCTGCATAAGTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011523.1-3479s1c1
Sequence:CCGGCCAAGGCTAGAACTGGAATAACTCGAGTTATTCCAGTTCTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011523.1-1266s1c1
Sequence:CCGGGCTAAATTCAAAGCCCATCATCTCGAGATGATGGGCTTTGAATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011523.1-1007s1c1
Sequence:CCGGCGGGTGACACACCTATGATAACTCGAGTTATCATAGGTGTGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011523.2-3990s21c1
Sequence:CCGGCTGTAGAGTACGTTGGTACAACTCGAGTTGTACCAACGTACTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011523.2-1062s21c1
Sequence:CCGGCGGGTGACACACCTATGATAACTCGAGTTATCATAGGTGTGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011523.2-2817s21c1
Sequence:CCGGGCACAGAACTTATGCAGACTTCTCGAGAAGTCTGCATAAGTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011523.2-2840s21c1
Sequence:CCGGGGGAATTATGGGACGATTATTCTCGAGAATAATCGTCCCATAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011523.2-3534s21c1
Sequence:CCGGCCAAGGCTAGAACTGGAATAACTCGAGTTATTCCAGTTCTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011523
VALIDATED
SYNJ2 MISSION shRNA Lentiviral Transduction Particles
synaptojanin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011523.1-3935s1c1
Sequence:CCGGCTGTAGAGTACGTTGGTACAACTCGAGTTGTACCAACGTACTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011523.1-2762s1c1
Sequence:CCGGGCACAGAACTTATGCAGACTTCTCGAGAAGTCTGCATAAGTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011523.1-3479s1c1
Sequence:CCGGCCAAGGCTAGAACTGGAATAACTCGAGTTATTCCAGTTCTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011523.1-1266s1c1
Sequence:CCGGGCTAAATTCAAAGCCCATCATCTCGAGATGATGGGCTTTGAATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011523.1-1007s1c1
Sequence:CCGGCGGGTGACACACCTATGATAACTCGAGTTATCATAGGTGTGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011523.2-3990s21c1
Sequence:CCGGCTGTAGAGTACGTTGGTACAACTCGAGTTGTACCAACGTACTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011523.2-1062s21c1
Sequence:CCGGCGGGTGACACACCTATGATAACTCGAGTTATCATAGGTGTGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011523.2-2817s21c1
Sequence:CCGGGCACAGAACTTATGCAGACTTCTCGAGAAGTCTGCATAAGTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011523.2-2840s21c1
Sequence:CCGGGGGAATTATGGGACGATTATTCTCGAGAATAATCGTCCCATAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011523.2-3534s21c1
Sequence:CCGGCCAAGGCTAGAACTGGAATAACTCGAGTTATTCCAGTTCTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks