EMAIL THIS PAGE TO A FRIEND

SYNJ2BP

synaptojanin 2 binding protein

Synonyms: ARIP2 OMP25
UniProtKB ID: P57105, Q49SH3, Q96IA4
Gene ID:
Mouse(24071) synaptojanin 2 binding protein
Rat(64531) synaptojanin 2 binding protein
Zebrafish(334599) synaptojanin 2 binding protein
chicken(430724) synaptojanin 2 binding protein
Horse(100049833) synaptojanin 2 binding protein
domestic cat(101081641) synaptojanin 2 binding protein
dog(490757) synaptojanin 2 binding protein
cow(525107) synaptojanin 2 binding protein
sheep(101121353) synaptojanin 2 binding protein
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1400613 Anti-SYNJ2BP antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025292 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025292 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025292 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018373 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU091861 MISSION® esiRNA esiRNA targeting mouse Cox16 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018373 Rosetta Predictions human pricing
NM_022599 Rosetta Predictions rat pricing
NM_025292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351849 predicted 220
2 SASI_Hs01_00168409 predicted 858
3 SASI_Hs01_00168410 predicted 729
4 SASI_Hs01_00168411 predicted 240
5 SASI_Hs01_00168412 predicted 617
6 SASI_Hs02_00351850 predicted 327
7 SASI_Hs01_00168414 predicted 540
8 SASI_Hs01_00168415 predicted 367
9 SASI_Hs02_00351851 predicted 309
10 SASI_Hs01_00168417 predicted 842
11 SASI_Hs01_00168408 predicted 271
12 SASI_Hs01_00168413 predicted 281
13 SASI_Hs01_00168416 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083792 predicted 617
2 SASI_Rn01_00083793 predicted 205
3 SASI_Rn01_00083794 predicted 643
4 SASI_Rn02_00263348 predicted 375
5 SASI_Rn01_00083796 predicted 609
6 SASI_Rn01_00083797 predicted 726
7 SASI_Rn01_00083798 predicted 196
8 SASI_Rn01_00083799 predicted 644
9 SASI_Rn01_00083800 predicted 307
10 SASI_Rn02_00263349 predicted 514
11 SASI_Rn01_00083795 predicted 563
12 SASI_Rn01_00083801 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093081 predicted 249
2 SASI_Mm01_00093082 predicted 650
3 SASI_Mm01_00093083 predicted 225
4 SASI_Mm01_00093084 predicted 616
5 SASI_Mm02_00327907 predicted 567
6 SASI_Mm01_00093085 predicted 239
7 SASI_Mm01_00093086 predicted 503
8 SASI_Mm01_00093087 predicted 202
9 SASI_Mm01_00093088 predicted 507
10 SASI_Mm02_00327908 predicted 412
11 SASI_Mm01_00093089 predicted 332
12 SASI_Mm01_00093090 predicted 492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025292
VALIDATED
SYNJ2BP MISSION shRNA Bacterial Glycerol Stock
synaptojanin 2 binding protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025292.6-3954s21c1
Sequence:CCGGGCCCACATTAAATAAGAACATCTCGAGATGTTCTTATTTAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025292.6-429s21c1
Sequence:CCGGCCAGTGCAGAATGGACCTATACTCGAGTATAGGTCCATTCTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025292.6-251s21c1
Sequence:CCGGCATCTACGTCAGCCGTATCAACTCGAGTTGATACGGCTGACGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025292.6-315s21c1
Sequence:CCGGGATAAGATCCTCTCGGTAAATCTCGAGATTTACCGAGAGGATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025292.6-539s21c1
Sequence:CCGGCTTCGTGAGATACCGAAAGCACTCGAGTGCTTTCGGTATCTCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025292.2-540s1c1
Sequence:CCGGCTTCGTGAGATACCGAAAGCACTCGAGTGCTTTCGGTATCTCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025292.2-430s1c1
Sequence:CCGGCCAGTGCAGAATGGACCTATACTCGAGTATAGGTCCATTCTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025292.2-252s1c1
Sequence:CCGGCATCTACGTCAGCCGTATCAACTCGAGTTGATACGGCTGACGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025292.2-316s1c1
Sequence:CCGGGATAAGATCCTCTCGGTAAATCTCGAGATTTACCGAGAGGATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025292.2-3954s1c1
Sequence:CCGGGCCCACATTAAATAAGAACATCTCGAGATGTTCTTATTTAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025292
VALIDATED
SYNJ2BP MISSION shRNA shRNA Plasmid DNA
synaptojanin 2 binding protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025292.6-3954s21c1
Sequence:CCGGGCCCACATTAAATAAGAACATCTCGAGATGTTCTTATTTAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025292.6-429s21c1
Sequence:CCGGCCAGTGCAGAATGGACCTATACTCGAGTATAGGTCCATTCTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025292.6-251s21c1
Sequence:CCGGCATCTACGTCAGCCGTATCAACTCGAGTTGATACGGCTGACGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025292.6-315s21c1
Sequence:CCGGGATAAGATCCTCTCGGTAAATCTCGAGATTTACCGAGAGGATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025292.6-539s21c1
Sequence:CCGGCTTCGTGAGATACCGAAAGCACTCGAGTGCTTTCGGTATCTCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025292.2-540s1c1
Sequence:CCGGCTTCGTGAGATACCGAAAGCACTCGAGTGCTTTCGGTATCTCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025292.2-430s1c1
Sequence:CCGGCCAGTGCAGAATGGACCTATACTCGAGTATAGGTCCATTCTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025292.2-252s1c1
Sequence:CCGGCATCTACGTCAGCCGTATCAACTCGAGTTGATACGGCTGACGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025292.2-316s1c1
Sequence:CCGGGATAAGATCCTCTCGGTAAATCTCGAGATTTACCGAGAGGATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025292.2-3954s1c1
Sequence:CCGGGCCCACATTAAATAAGAACATCTCGAGATGTTCTTATTTAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025292
VALIDATED
SYNJ2BP MISSION shRNA Lentiviral Transduction Particles
synaptojanin 2 binding protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025292.6-3954s21c1
Sequence:CCGGGCCCACATTAAATAAGAACATCTCGAGATGTTCTTATTTAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025292.6-429s21c1
Sequence:CCGGCCAGTGCAGAATGGACCTATACTCGAGTATAGGTCCATTCTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025292.6-251s21c1
Sequence:CCGGCATCTACGTCAGCCGTATCAACTCGAGTTGATACGGCTGACGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025292.6-315s21c1
Sequence:CCGGGATAAGATCCTCTCGGTAAATCTCGAGATTTACCGAGAGGATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025292.6-539s21c1
Sequence:CCGGCTTCGTGAGATACCGAAAGCACTCGAGTGCTTTCGGTATCTCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025292.2-540s1c1
Sequence:CCGGCTTCGTGAGATACCGAAAGCACTCGAGTGCTTTCGGTATCTCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025292.2-430s1c1
Sequence:CCGGCCAGTGCAGAATGGACCTATACTCGAGTATAGGTCCATTCTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025292.2-252s1c1
Sequence:CCGGCATCTACGTCAGCCGTATCAACTCGAGTTGATACGGCTGACGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025292.2-316s1c1
Sequence:CCGGGATAAGATCCTCTCGGTAAATCTCGAGATTTACCGAGAGGATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025292.2-3954s1c1
Sequence:CCGGGCCCACATTAAATAAGAACATCTCGAGATGTTCTTATTTAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018373
VALIDATED
SYNJ2BP MISSION shRNA Bacterial Glycerol Stock
synaptojanin 2 binding protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-424s1c1
Sequence:CCGGCCCAAGTGGTATTCCCATATTCTCGAGAATATGGGAATACCACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-389s1c1
Sequence:CCGGCAGAATGGACCTATAGGACATCTCGAGATGTCCTATAGGTCCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-260s1c1
Sequence:CCGGCAGGAGGGTGATAAGATCCTTCTCGAGAAGGATCTTATCACCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-577s1c1
Sequence:CCGGCCTGCTATTCTGCCATGTCTTCTCGAGAAGACATGGCAGAATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-491s1c1
Sequence:CCGGGCTTTCATGAGATACCGGCAACTCGAGTTGCCGGTATCTCATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-323s1c1
Sequence:CCGGGCTGTAGACCTCTTTCGTAATCTCGAGATTACGAAAGAGGTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-731s1c1
Sequence:CCGGGCTTAGAACAAATGAGGAGTTCTCGAGAACTCCTCATTTGTTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-269s1c1
Sequence:CCGGGATAAGATCCTTTCGGCAAATCTCGAGATTTGCCGAAAGGATCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-116s1c1
Sequence:CCGGGAAGAGATCAATCTTACCAGACTCGAGTCTGGTAAGATTGATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-615s1c1
Sequence:CCGGCCAGATTTGAAGTGACTGATACTCGAGTATCAGTCACTTCAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018373
VALIDATED
SYNJ2BP MISSION shRNA shRNA Plasmid DNA
synaptojanin 2 binding protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-424s1c1
Sequence:CCGGCCCAAGTGGTATTCCCATATTCTCGAGAATATGGGAATACCACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-389s1c1
Sequence:CCGGCAGAATGGACCTATAGGACATCTCGAGATGTCCTATAGGTCCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-260s1c1
Sequence:CCGGCAGGAGGGTGATAAGATCCTTCTCGAGAAGGATCTTATCACCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-577s1c1
Sequence:CCGGCCTGCTATTCTGCCATGTCTTCTCGAGAAGACATGGCAGAATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-491s1c1
Sequence:CCGGGCTTTCATGAGATACCGGCAACTCGAGTTGCCGGTATCTCATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-323s1c1
Sequence:CCGGGCTGTAGACCTCTTTCGTAATCTCGAGATTACGAAAGAGGTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-731s1c1
Sequence:CCGGGCTTAGAACAAATGAGGAGTTCTCGAGAACTCCTCATTTGTTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-269s1c1
Sequence:CCGGGATAAGATCCTTTCGGCAAATCTCGAGATTTGCCGAAAGGATCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-116s1c1
Sequence:CCGGGAAGAGATCAATCTTACCAGACTCGAGTCTGGTAAGATTGATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-615s1c1
Sequence:CCGGCCAGATTTGAAGTGACTGATACTCGAGTATCAGTCACTTCAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018373
VALIDATED
SYNJ2BP MISSION shRNA Lentiviral Transduction Particles
synaptojanin 2 binding protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-424s1c1
Sequence:CCGGCCCAAGTGGTATTCCCATATTCTCGAGAATATGGGAATACCACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-389s1c1
Sequence:CCGGCAGAATGGACCTATAGGACATCTCGAGATGTCCTATAGGTCCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-260s1c1
Sequence:CCGGCAGGAGGGTGATAAGATCCTTCTCGAGAAGGATCTTATCACCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-577s1c1
Sequence:CCGGCCTGCTATTCTGCCATGTCTTCTCGAGAAGACATGGCAGAATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-491s1c1
Sequence:CCGGGCTTTCATGAGATACCGGCAACTCGAGTTGCCGGTATCTCATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-323s1c1
Sequence:CCGGGCTGTAGACCTCTTTCGTAATCTCGAGATTACGAAAGAGGTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-731s1c1
Sequence:CCGGGCTTAGAACAAATGAGGAGTTCTCGAGAACTCCTCATTTGTTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-269s1c1
Sequence:CCGGGATAAGATCCTTTCGGCAAATCTCGAGATTTGCCGAAAGGATCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018373.1-116s1c1
Sequence:CCGGGAAGAGATCAATCTTACCAGACTCGAGTCTGGTAAGATTGATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018373.1-615s1c1
Sequence:CCGGCCAGATTTGAAGTGACTGATACTCGAGTATCAGTCACTTCAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks