EMAIL THIS PAGE TO A FRIEND

SYNM

synemin, intermediate filament protein

Synonyms: DMN SYN
UniProtKB ID: O15061, A7E2Y2, Q2TBJ4, Q5NJJ9, Q8TE61, Q8TE62
Gene ID:
Human(23336) Summary: The protein encoded by this gene is an intermediate filament (IF) family member. IF proteins are cytoskeletal proteins that confer resistance to mechanical stress and are encoded by a dispersed multigene family. This protein has been found to form a linkage between desmin, which is a subunit of the IF network, and the extracellular matrix, and provides an important structural support in muscle. Two alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(233335) synemin, intermediate filament protein
Rat(308709) synemin, intermediate filament protein
Zebrafish(558800) synemin, intermediate filament protein
domestic cat(101101471) synemin, intermediate filament protein
dog(479024) synemin, intermediate filament protein
chicken(395599) synemin, intermediate filament protein
domestic guinea pig(100735122) synemin, intermediate filament protein
naked mole-rat(101709632) synemin, intermediate filament protein
Domestic Rabbit(100008842) synemin, intermediate filament protein
cow(514186) synemin, intermediate filament protein
sheep(101111130) synemin, intermediate filament protein
187 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015286 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079201 MISSION® esiRNA esiRNA human SYNM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015286 Rosetta Predictions human pricing
NM_145728 Rosetta Predictions human pricing
NM_001134858 Rosetta Predictions rat pricing
XM_001055724 Rosetta Predictions rat pricing
XM_001058219 Rosetta Predictions rat pricing
XM_001058280 Rosetta Predictions rat pricing
NM_183312 Rosetta Predictions mouse pricing
NM_201639 Rosetta Predictions mouse pricing
NM_207663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206164 predicted 1729
2 SASI_Hs01_00206165 predicted 1653
3 SASI_Hs01_00206166 predicted 2491
4 SASI_Hs02_00347473 predicted 1307
5 SASI_Hs01_00206167 predicted 1843
6 SASI_Hs01_00206169 predicted 1515
7 SASI_Hs02_00347474 predicted 2166
8 SASI_Hs01_00206171 predicted 1135
9 SASI_Hs01_00206172 predicted 1772
10 SASI_Hs01_00206173 predicted 1719
11 SASI_Hs01_00206168 predicted 2591
12 SASI_Hs01_00206170 predicted 2168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122588 predicted 1734
2 SASI_Hs01_00122589 predicted 1652
3 SASI_Hs01_00122590 predicted 2482
4 SASI_Hs02_00365325 predicted 1301
5 SASI_Hs01_00122591 predicted 1850
6 SASI_Hs01_00122593 predicted 1510
7 SASI_Hs02_00365326 predicted 2172
8 SASI_Hs01_00122595 predicted 1138
9 SASI_Hs01_00122596 predicted 1771
10 SASI_Hs01_00122597 predicted 1726
11 SASI_Hs01_00122592 predicted 2585
12 SASI_Hs01_00122594 predicted 2175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258784 predicted 1252
2 SASI_Rn02_00258785 predicted 1943
3 SASI_Rn02_00258786 predicted 2399
4 SASI_Rn02_00258787 predicted 4836
5 SASI_Rn02_00258788 predicted 1482
6 SASI_Rn02_00258789 predicted 1974
7 SASI_Rn02_00258790 predicted 1235
8 SASI_Rn02_00258791 predicted 4790
9 SASI_Rn02_00258792 predicted 3581
10 SASI_Rn02_00258793 predicted 2696
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280744 predicted 1245
2 SASI_Rn02_00280745 predicted 1936
3 SASI_Rn02_00280746 predicted 3926
4 SASI_Rn02_00280747 predicted 2587
5 SASI_Rn02_00280748 predicted 1972
6 SASI_Rn02_00280749 predicted 1237
7 SASI_Rn02_00280750 predicted 1291
8 SASI_Rn02_00280751 predicted 3888
9 SASI_Rn02_00280752 predicted 2694
10 SASI_Rn02_00280753 predicted 3237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289012 predicted 1251
2 SASI_Rn02_00289013 predicted 1938
3 SASI_Rn02_00289014 predicted 2407
4 SASI_Rn02_00289015 predicted 4839
5 SASI_Rn02_00289016 predicted 1479
6 SASI_Rn02_00289017 predicted 1976
7 SASI_Rn02_00289018 predicted 1232
8 SASI_Rn02_00289019 predicted 4798
9 SASI_Rn02_00289020 predicted 3579
10 SASI_Rn02_00289021 predicted 2700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289196 predicted 1245
2 SASI_Rn02_00289197 predicted 1944
3 SASI_Rn02_00289198 predicted 2404
4 SASI_Rn02_00289199 predicted 3931
5 SASI_Rn02_00289200 predicted 1484
6 SASI_Rn02_00289201 predicted 2589
7 SASI_Rn02_00289202 predicted 1977
8 SASI_Rn02_00289203 predicted 1230
9 SASI_Rn02_00289204 predicted 3893
10 SASI_Rn02_00289205 predicted 3584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070403 predicted 1444
2 SASI_Mm01_00070404 predicted 1547
3 SASI_Mm01_00070405 predicted 308
4 SASI_Mm01_00070406 predicted 1469
5 SASI_Mm02_00350427 predicted 1039
6 SASI_Mm01_00070408 predicted 1633
7 SASI_Mm02_00350428 predicted 1554
8 SASI_Mm01_00070412 predicted 265
9 SASI_Mm02_00350429 predicted 1007
10 SASI_Mm02_00350430 predicted 311
11 SASI_Mm01_00070407 predicted 1505
12 SASI_Mm01_00070409 predicted 1538
13 SASI_Mm01_00070410 predicted 1457
14 SASI_Mm01_00070411 predicted 1541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116880 predicted 4796
2 SASI_Mm02_00351700 predicted 4137
3 SASI_Mm02_00351701 predicted 3789
4 SASI_Mm02_00351702 predicted 1734
5 SASI_Mm02_00351703 predicted 2656
6 SASI_Mm02_00351704 predicted 4017
7 SASI_Mm02_00351705 predicted 2195
8 SASI_Mm02_00351706 predicted 1119
9 SASI_Mm02_00351707 predicted 4155
10 SASI_Mm02_00351708 predicted 3445
11 SASI_Mm01_00116881 predicted 5144
12 SASI_Mm01_00116882 predicted 4861
13 SASI_Mm01_00116883 predicted 261
14 SASI_Mm01_00116884 predicted 5050
15 SASI_Mm01_00116885 predicted 4783
16 SASI_Mm01_00116886 predicted 5047
17 SASI_Mm01_00116887 predicted 4946
18 SASI_Mm01_00116888 predicted 4691
19 SASI_Mm01_00116889 predicted 4895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031367 predicted 3897
2 SASI_Mm02_00352181 predicted 2123
3 SASI_Mm02_00352182 predicted 1733
4 SASI_Mm01_00031372 predicted 3922
5 SASI_Mm02_00352183 predicted 2650
6 SASI_Mm02_00352184 predicted 2643
7 SASI_Mm02_00352185 predicted 2190
8 SASI_Mm02_00352186 predicted 2838
9 SASI_Mm02_00352187 predicted 1118
10 SASI_Mm02_00352188 predicted 3445
11 SASI_Mm01_00031368 predicted 4238
12 SASI_Mm01_00031369 predicted 3951
13 SASI_Mm01_00031370 predicted 264
14 SASI_Mm01_00031371 predicted 4137
15 SASI_Mm01_00031373 predicted 4140
16 SASI_Mm01_00031374 predicted 4035
17 SASI_Mm01_00031375 predicted 3788
18 SASI_Mm01_00031376 predicted 3985
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015286
VALIDATED
SYNM MISSION shRNA Bacterial Glycerol Stock
synemin, intermediate filament protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015286.4-4601s1c1
Sequence:CCGGCGCTTACAGTACCATTTCATTCTCGAGAATGAAATGGTACTGTAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015286.4-2498s1c1
Sequence:CCGGGCGATGTCACATTCTCAGTTACTCGAGTAACTGAGAATGTGACATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015286.4-1119s1c1
Sequence:CCGGGCCGTCAGAATTCAGAAACAACTCGAGTTGTTTCTGAATTCTGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015286.4-3121s1c1
Sequence:CCGGGCTGAAGTCAACGTCTCACAACTCGAGTTGTGAGACGTTGACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015286.4-3750s1c1
Sequence:CCGGGCAGGCCATGTTTGATAAGAACTCGAGTTCTTATCAAACATGGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015286.5-3791s21c1
Sequence:CCGGTAGACCAAAGGTCGGTGATTTCTCGAGAAATCACCGACCTTTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015286.5-4601s21c1
Sequence:CCGGCGCTTACAGTACCATTTCATTCTCGAGAATGAAATGGTACTGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015286.5-1570s21c1
Sequence:CCGGTCGGAAAGCACACGGTCAAATCTCGAGATTTGACCGTGTGCTTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015286.5-3121s21c1
Sequence:CCGGGCTGAAGTCAACGTCTCACAACTCGAGTTGTGAGACGTTGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015286.5-1119s21c1
Sequence:CCGGGCCGTCAGAATTCAGAAACAACTCGAGTTGTTTCTGAATTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015286
VALIDATED
SYNM MISSION shRNA shRNA Plasmid DNA
synemin, intermediate filament protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015286.4-4601s1c1
Sequence:CCGGCGCTTACAGTACCATTTCATTCTCGAGAATGAAATGGTACTGTAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015286.4-2498s1c1
Sequence:CCGGGCGATGTCACATTCTCAGTTACTCGAGTAACTGAGAATGTGACATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015286.4-1119s1c1
Sequence:CCGGGCCGTCAGAATTCAGAAACAACTCGAGTTGTTTCTGAATTCTGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015286.4-3121s1c1
Sequence:CCGGGCTGAAGTCAACGTCTCACAACTCGAGTTGTGAGACGTTGACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015286.4-3750s1c1
Sequence:CCGGGCAGGCCATGTTTGATAAGAACTCGAGTTCTTATCAAACATGGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015286.5-3791s21c1
Sequence:CCGGTAGACCAAAGGTCGGTGATTTCTCGAGAAATCACCGACCTTTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015286.5-4601s21c1
Sequence:CCGGCGCTTACAGTACCATTTCATTCTCGAGAATGAAATGGTACTGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015286.5-1570s21c1
Sequence:CCGGTCGGAAAGCACACGGTCAAATCTCGAGATTTGACCGTGTGCTTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015286.5-3121s21c1
Sequence:CCGGGCTGAAGTCAACGTCTCACAACTCGAGTTGTGAGACGTTGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015286.5-1119s21c1
Sequence:CCGGGCCGTCAGAATTCAGAAACAACTCGAGTTGTTTCTGAATTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015286
VALIDATED
SYNM MISSION shRNA Lentiviral Transduction Particles
synemin, intermediate filament protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015286.4-4601s1c1
Sequence:CCGGCGCTTACAGTACCATTTCATTCTCGAGAATGAAATGGTACTGTAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015286.4-2498s1c1
Sequence:CCGGGCGATGTCACATTCTCAGTTACTCGAGTAACTGAGAATGTGACATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015286.4-1119s1c1
Sequence:CCGGGCCGTCAGAATTCAGAAACAACTCGAGTTGTTTCTGAATTCTGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015286.4-3121s1c1
Sequence:CCGGGCTGAAGTCAACGTCTCACAACTCGAGTTGTGAGACGTTGACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015286.4-3750s1c1
Sequence:CCGGGCAGGCCATGTTTGATAAGAACTCGAGTTCTTATCAAACATGGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015286.5-3791s21c1
Sequence:CCGGTAGACCAAAGGTCGGTGATTTCTCGAGAAATCACCGACCTTTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015286.5-4601s21c1
Sequence:CCGGCGCTTACAGTACCATTTCATTCTCGAGAATGAAATGGTACTGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015286.5-1570s21c1
Sequence:CCGGTCGGAAAGCACACGGTCAAATCTCGAGATTTGACCGTGTGCTTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015286.5-3121s21c1
Sequence:CCGGGCTGAAGTCAACGTCTCACAACTCGAGTTGTGAGACGTTGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015286.5-1119s21c1
Sequence:CCGGGCCGTCAGAATTCAGAAACAACTCGAGTTGTTTCTGAATTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207663
SYNM MISSION shRNA Bacterial Glycerol Stock
synemin, intermediate filament protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207663.2-3948s1c1
Sequence:CCGGGCTGGTTATCAATACCTTTATCTCGAGATAAAGGTATTGATAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207663.2-1951s1c1
Sequence:CCGGGCTCTCTGCAAAGTGACTCAACTCGAGTTGAGTCACTTTGCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207663.2-1267s1c1
Sequence:CCGGCCCGCCATTCTTCCTCAGCTACTCGAGTAGCTGAGGAAGAATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207663.2-2061s1c1
Sequence:CCGGCCGGACACAAAGGTCACTTATCTCGAGATAAGTGACCTTTGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207663.2-3711s1c1
Sequence:CCGGGCTGGATTTGACAAGACGGTACTCGAGTACCGTCTTGTCAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207663.3-2335s21c1
Sequence:CCGGGGGAGAGCTAAAGTCGTAAATCTCGAGATTTACGACTTTAGCTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207663.3-1497s21c1
Sequence:CCGGGCGGGCTACAGAGTCTGTTATCTCGAGATAACAGACTCTGTAGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207663
SYNM MISSION shRNA shRNA Plasmid DNA
synemin, intermediate filament protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207663.2-3948s1c1
Sequence:CCGGGCTGGTTATCAATACCTTTATCTCGAGATAAAGGTATTGATAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207663.2-1951s1c1
Sequence:CCGGGCTCTCTGCAAAGTGACTCAACTCGAGTTGAGTCACTTTGCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207663.2-1267s1c1
Sequence:CCGGCCCGCCATTCTTCCTCAGCTACTCGAGTAGCTGAGGAAGAATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207663.2-2061s1c1
Sequence:CCGGCCGGACACAAAGGTCACTTATCTCGAGATAAGTGACCTTTGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207663.2-3711s1c1
Sequence:CCGGGCTGGATTTGACAAGACGGTACTCGAGTACCGTCTTGTCAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207663.3-2335s21c1
Sequence:CCGGGGGAGAGCTAAAGTCGTAAATCTCGAGATTTACGACTTTAGCTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207663.3-1497s21c1
Sequence:CCGGGCGGGCTACAGAGTCTGTTATCTCGAGATAACAGACTCTGTAGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207663
SYNM MISSION shRNA Lentiviral Transduction Particles
synemin, intermediate filament protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207663.2-3948s1c1
Sequence:CCGGGCTGGTTATCAATACCTTTATCTCGAGATAAAGGTATTGATAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207663.2-1951s1c1
Sequence:CCGGGCTCTCTGCAAAGTGACTCAACTCGAGTTGAGTCACTTTGCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207663.2-1267s1c1
Sequence:CCGGCCCGCCATTCTTCCTCAGCTACTCGAGTAGCTGAGGAAGAATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207663.2-2061s1c1
Sequence:CCGGCCGGACACAAAGGTCACTTATCTCGAGATAAGTGACCTTTGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207663.2-3711s1c1
Sequence:CCGGGCTGGATTTGACAAGACGGTACTCGAGTACCGTCTTGTCAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207663.3-2335s21c1
Sequence:CCGGGGGAGAGCTAAAGTCGTAAATCTCGAGATTTACGACTTTAGCTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207663.3-1497s21c1
Sequence:CCGGGCGGGCTACAGAGTCTGTTATCTCGAGATAACAGACTCTGTAGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks