EMAIL THIS PAGE TO A FRIEND

SYNPO2

synaptopodin 2

UniProtKB ID: Q9UMS6, B2RWP6, B2Y8J9, Q9UK89
Gene ID:
Mouse(118449) synaptopodin 2
Rat(499702) synaptopodin 2
chicken(428768) synaptopodin 2
Horse(100064021) synaptopodin 2
domestic cat(101094094) synaptopodin 2
dog(611023) synaptopodin 2
naked mole-rat(101710088) synaptopodin 2
cow(540340) synaptopodin 2
sheep(101110330) synaptopodin 2
Gene Class: Cytoskeleton
214 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133477 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_619958 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_619958 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_619958 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133477 Rosetta Predictions human pricing
XM_001074385 Rosetta Predictions rat pricing
XM_575030 Rosetta Predictions rat pricing
XM_001005167 Rosetta Predictions mouse pricing
XM_619958 Rosetta Predictions mouse pricing
XM_901510 Rosetta Predictions mouse pricing
XM_915986 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012191 predicted 1478
2 SASI_Hs01_00012192 predicted 3506
3 SASI_Hs01_00012193 predicted 1514
4 SASI_Hs01_00012194 predicted 3599
5 SASI_Hs01_00012195 predicted 885
6 SASI_Hs01_00012196 predicted 891
7 SASI_Hs01_00012197 predicted 3245
8 SASI_Hs02_00363199 predicted 3784
9 SASI_Hs01_00012199 predicted 2181
10 SASI_Hs01_00012200 predicted 2843
11 SASI_Hs01_00012198 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346010 predicted 2492
2 SASI_Rn02_00346011 predicted 1956
3 SASI_Rn02_00346012 predicted 1276
4 SASI_Rn02_00346013 predicted 511
5 SASI_Rn02_00346014 predicted 2861
6 SASI_Rn02_00346015 predicted 3027
7 SASI_Rn02_00346016 predicted 3362
8 SASI_Rn02_00346017 predicted 3293
9 SASI_Rn02_00346018 predicted 1350
10 SASI_Rn02_00346019 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402940 predicted 203
2 SASI_Rn02_00402941 predicted 1957
3 SASI_Rn02_00402942 predicted 1278
4 SASI_Rn02_00402943 predicted 950
5 SASI_Rn02_00402944 predicted 509
6 SASI_Rn02_00402945 predicted 1661
7 SASI_Rn02_00402946 predicted 1352
8 SASI_Rn02_00402947 predicted 981
9 SASI_Rn02_00402948 predicted 1272
10 SASI_Rn02_00402949 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271197 predicted 2784
2 SASI_Mm01_00271198 predicted 1126
3 SASI_Mm01_00271199 predicted 2886
4 SASI_Mm01_00271200 predicted 2616
5 SASI_Mm01_00271201 predicted 2566
6 SASI_Mm01_00271202 predicted 1752
7 SASI_Mm01_00271203 predicted 2403
8 SASI_Mm01_00271204 predicted 1501
9 SASI_Mm01_00271205 predicted 2486
10 SASI_Mm01_00271206 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619958 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276568 predicted 1710
2 SASI_Mm01_00276569 predicted 3197
3 SASI_Mm01_00276570 predicted 3142
4 SASI_Mm01_00276571 predicted 2327
5 SASI_Mm01_00276572 predicted 651
6 SASI_Mm02_00427522 predicted 2156
7 SASI_Mm01_00276573 predicted 558
8 SASI_Mm01_00276574 predicted 2988
9 SASI_Mm02_00427523 predicted 1075
10 SASI_Mm01_00276575 predicted 2076
11 SASI_Mm01_00276576 predicted 3669
12 SASI_Mm01_00276577 predicted 3068
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240071 predicted 589
2 SASI_Mm01_00240072 predicted 2076
3 SASI_Mm01_00240073 predicted 2020
4 SASI_Mm01_00240074 predicted 1205
5 SASI_Mm01_00240075 predicted 2364
6 SASI_Mm01_00240076 predicted 1858
7 SASI_Mm01_00240077 predicted 947
8 SASI_Mm01_00240078 predicted 2264
9 SASI_Mm01_00240079 predicted 1936
10 SASI_Mm01_00240080 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439922 predicted 1709
2 SASI_Mm02_00439923 predicted 3200
3 SASI_Mm02_00439924 predicted 3144
4 SASI_Mm02_00439925 predicted 2333
5 SASI_Mm02_00439926 predicted 654
6 SASI_Mm02_00439927 predicted 2151
7 SASI_Mm02_00439928 predicted 563
8 SASI_Mm02_00439929 predicted 2987
9 SASI_Mm02_00439930 predicted 1075
10 SASI_Mm02_00439931 predicted 2075
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133477
SYNPO2 MISSION shRNA Bacterial Glycerol Stock
synaptopodin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133477.1-3116s1c1
Sequence:CCGGGCATCCTTGTTTACTTTCCAACTCGAGTTGGAAAGTAAACAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133477.1-1571s1c1
Sequence:CCGGGTTGTGAACTTTGACTGGGATCTCGAGATCCCAGTCAAAGTTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133477.1-398s1c1
Sequence:CCGGGAAGTCATCAAGCTCATGGAACTCGAGTTCCATGAGCTTGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133477.1-1791s1c1
Sequence:CCGGCCACGACTTCTTACCAAAGAACTCGAGTTCTTTGGTAAGAAGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133477.1-460s1c1
Sequence:CCGGCAGTGGAATAAGTGAGGCTTTCTCGAGAAAGCCTCACTTATTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139826    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133477.1-4628s1c1
Sequence:CCGGCCTCCTGAATAGCTGGGATTACTCGAGTAATCCCAGCTATTCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133477.1-5378s1c1
Sequence:CCGGCCGATGTAACAAGTGGTGCTTCTCGAGAAGCACCACTTGTTACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133477.1-1946s1c1
Sequence:CCGGCCCATGAATAGAACGGCCAAACTCGAGTTTGGCCGTTCTATTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133477.1-881s1c1
Sequence:CCGGCCAGACCCTAACTTGTCACATCTCGAGATGTGACAAGTTAGGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133477.1-5225s1c1
Sequence:CCGGGCAGGCTTTGTGTTACGTGTTCTCGAGAACACGTAACACAAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133477
SYNPO2 MISSION shRNA shRNA Plasmid DNA
synaptopodin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133477.1-3116s1c1
Sequence:CCGGGCATCCTTGTTTACTTTCCAACTCGAGTTGGAAAGTAAACAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133477.1-1571s1c1
Sequence:CCGGGTTGTGAACTTTGACTGGGATCTCGAGATCCCAGTCAAAGTTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133477.1-398s1c1
Sequence:CCGGGAAGTCATCAAGCTCATGGAACTCGAGTTCCATGAGCTTGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133477.1-1791s1c1
Sequence:CCGGCCACGACTTCTTACCAAAGAACTCGAGTTCTTTGGTAAGAAGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133477.1-460s1c1
Sequence:CCGGCAGTGGAATAAGTGAGGCTTTCTCGAGAAAGCCTCACTTATTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139826    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133477.1-4628s1c1
Sequence:CCGGCCTCCTGAATAGCTGGGATTACTCGAGTAATCCCAGCTATTCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133477.1-5378s1c1
Sequence:CCGGCCGATGTAACAAGTGGTGCTTCTCGAGAAGCACCACTTGTTACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133477.1-1946s1c1
Sequence:CCGGCCCATGAATAGAACGGCCAAACTCGAGTTTGGCCGTTCTATTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133477.1-881s1c1
Sequence:CCGGCCAGACCCTAACTTGTCACATCTCGAGATGTGACAAGTTAGGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133477.1-5225s1c1
Sequence:CCGGGCAGGCTTTGTGTTACGTGTTCTCGAGAACACGTAACACAAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133477
SYNPO2 MISSION shRNA Lentiviral Transduction Particles
synaptopodin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133477.1-3116s1c1
Sequence:CCGGGCATCCTTGTTTACTTTCCAACTCGAGTTGGAAAGTAAACAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133477.1-1571s1c1
Sequence:CCGGGTTGTGAACTTTGACTGGGATCTCGAGATCCCAGTCAAAGTTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133477.1-398s1c1
Sequence:CCGGGAAGTCATCAAGCTCATGGAACTCGAGTTCCATGAGCTTGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133477.1-1791s1c1
Sequence:CCGGCCACGACTTCTTACCAAAGAACTCGAGTTCTTTGGTAAGAAGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133477.1-460s1c1
Sequence:CCGGCAGTGGAATAAGTGAGGCTTTCTCGAGAAAGCCTCACTTATTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139826    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133477.1-4628s1c1
Sequence:CCGGCCTCCTGAATAGCTGGGATTACTCGAGTAATCCCAGCTATTCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133477.1-5378s1c1
Sequence:CCGGCCGATGTAACAAGTGGTGCTTCTCGAGAAGCACCACTTGTTACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133477.1-1946s1c1
Sequence:CCGGCCCATGAATAGAACGGCCAAACTCGAGTTTGGCCGTTCTATTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133477.1-881s1c1
Sequence:CCGGCCAGACCCTAACTTGTCACATCTCGAGATGTGACAAGTTAGGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133477.1-5225s1c1
Sequence:CCGGGCAGGCTTTGTGTTACGTGTTCTCGAGAACACGTAACACAAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080451
SYNPO2 MISSION shRNA Bacterial Glycerol Stock
synaptopodin 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080451.1-961s1c1
Sequence:CCGGGCCTTCTATGATTCATCTGAACTCGAGTTCAGATGAATCATAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080451.1-280s1c1
Sequence:CCGGGAGATAAGTGAGGTTGCATTTCTCGAGAAATGCAACCTCACTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-354s1c1
Sequence:CCGGCAACACCCAAGTTGTGAACTTCTCGAGAAGTTCACAACTTGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-1525s1c1
Sequence:CCGGGCACCCACACCATTAGTAAATCTCGAGATTTACTAATGGTGTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-1953s1c1
Sequence:CCGGCCCTCAGAAGTCAACAGTCAACTCGAGTTGACTGTTGACTTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-1174s1c1
Sequence:CCGGGAAGAAGACTACCTCAGTTTACTCGAGTAAACTGAGGTAGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-359s1c1
Sequence:CCGGCCCAAGTTGTGAACTTTGATTCTCGAGAATCAAAGTTCACAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080451
SYNPO2 MISSION shRNA shRNA Plasmid DNA
synaptopodin 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080451.1-961s1c1
Sequence:CCGGGCCTTCTATGATTCATCTGAACTCGAGTTCAGATGAATCATAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080451.1-280s1c1
Sequence:CCGGGAGATAAGTGAGGTTGCATTTCTCGAGAAATGCAACCTCACTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-354s1c1
Sequence:CCGGCAACACCCAAGTTGTGAACTTCTCGAGAAGTTCACAACTTGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-1525s1c1
Sequence:CCGGGCACCCACACCATTAGTAAATCTCGAGATTTACTAATGGTGTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-1953s1c1
Sequence:CCGGCCCTCAGAAGTCAACAGTCAACTCGAGTTGACTGTTGACTTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-1174s1c1
Sequence:CCGGGAAGAAGACTACCTCAGTTTACTCGAGTAAACTGAGGTAGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-359s1c1
Sequence:CCGGCCCAAGTTGTGAACTTTGATTCTCGAGAATCAAAGTTCACAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080451
SYNPO2 MISSION shRNA Lentiviral Transduction Particles
synaptopodin 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080451.1-961s1c1
Sequence:CCGGGCCTTCTATGATTCATCTGAACTCGAGTTCAGATGAATCATAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080451.1-280s1c1
Sequence:CCGGGAGATAAGTGAGGTTGCATTTCTCGAGAAATGCAACCTCACTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-354s1c1
Sequence:CCGGCAACACCCAAGTTGTGAACTTCTCGAGAAGTTCACAACTTGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-1525s1c1
Sequence:CCGGGCACCCACACCATTAGTAAATCTCGAGATTTACTAATGGTGTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-1953s1c1
Sequence:CCGGCCCTCAGAAGTCAACAGTCAACTCGAGTTGACTGTTGACTTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-1174s1c1
Sequence:CCGGGAAGAAGACTACCTCAGTTTACTCGAGTAAACTGAGGTAGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080451.1-359s1c1
Sequence:CCGGCCCAAGTTGTGAACTTTGATTCTCGAGAATCAAAGTTCACAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_619958
SYNPO2 MISSION shRNA Bacterial Glycerol Stock
synaptopodin 2
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000215695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_619958.3-4202s1c1
Sequence:CCGGGATATTCTGGCACTTATATAACTCGAGTTATATAAGTGCCAGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_619958
SYNPO2 MISSION shRNA shRNA Plasmid DNA
synaptopodin 2
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000215695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_619958.3-4202s1c1
Sequence:CCGGGATATTCTGGCACTTATATAACTCGAGTTATATAAGTGCCAGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_619958
SYNPO2 MISSION shRNA Lentiviral Transduction Particles
synaptopodin 2
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000215695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_619958.3-4202s1c1
Sequence:CCGGGATATTCTGGCACTTATATAACTCGAGTTATATAAGTGCCAGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks