EMAIL THIS PAGE TO A FRIEND

SYNPO2L

synaptopodin 2-like

UniProtKB ID: Q9H987, A5PKV9, Q68A20
Gene ID:
Mouse(68760) synaptopodin 2-like
Rat(305675) synaptopodin 2-like
cow(101905578) synaptopodin 2-like
sheep(101108364) synaptopodin 2-like
naked mole-rat(101709365) synaptopodin 2-like
domestic guinea pig(100719988) synaptopodin 2-like
chicken(423743) synaptopodin 2-like
Horse(100072866) synaptopodin 2-like
domestic cat(101087685) synaptopodin 2-like
dog(489048) synaptopodin 2-like
Gene Class: Cytoskeleton
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0126 AQUA Peptide TIASLLTAAPNPHS[K] dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024875 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175132 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175132 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175132 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114133 Rosetta Predictions human pricing
NM_024875 Rosetta Predictions human pricing
XM_001064648 Rosetta Predictions rat pricing
XM_223791 Rosetta Predictions rat pricing
NM_175132 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326334 predicted 1204
2 SASI_Hs02_00326335 predicted 2504
3 SASI_Hs02_00326336 predicted 2702
4 SASI_Hs02_00326337 predicted 1585
5 SASI_Hs02_00326338 predicted 3115
6 SASI_Hs02_00326339 predicted 2704
7 SASI_Hs02_00326340 predicted 2108
8 SASI_Hs02_00326341 predicted 2046
9 SASI_Hs02_00326342 predicted 3167
10 SASI_Hs02_00326343 predicted 2102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357471 predicted 404
2 SASI_Hs01_00126115 predicted 1700
3 SASI_Hs02_00357472 predicted 1896
4 SASI_Hs01_00126117 predicted 788
5 SASI_Hs01_00126118 predicted 2315
6 SASI_Hs02_00357473 predicted 1902
7 SASI_Hs02_00357474 predicted 1314
8 SASI_Hs01_00126120 predicted 1247
9 SASI_Hs02_00357475 predicted 2359
10 SASI_Hs01_00126121 predicted 1295
11 SASI_Hs01_00126114 predicted 773
12 SASI_Hs01_00126116 predicted 2558
13 SASI_Hs01_00126119 predicted 2493
14 SASI_Hs01_00126122 predicted 2492
15 SASI_Hs01_00126123 predicted 1874
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311312 predicted 2541
2 SASI_Rn02_00311313 predicted 1563
3 SASI_Rn02_00311314 predicted 2716
4 SASI_Rn02_00311315 predicted 2279
5 SASI_Rn02_00311316 predicted 2142
6 SASI_Rn02_00311317 predicted 1937
7 SASI_Rn02_00311318 predicted 587
8 SASI_Rn02_00311319 predicted 1422
9 SASI_Rn02_00311320 predicted 2505
10 SASI_Rn02_00311321 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381670 predicted 1915
2 SASI_Rn02_00381671 predicted 2546
3 SASI_Rn02_00381672 predicted 726
4 SASI_Rn02_00381673 predicted 695
5 SASI_Rn02_00381674 predicted 577
6 SASI_Rn02_00381675 predicted 2280
7 SASI_Rn02_00381676 predicted 415
8 SASI_Rn02_00381677 predicted 1932
9 SASI_Rn02_00381678 predicted 276
10 SASI_Rn02_00381679 predicted 2228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167660 predicted 3065
2 SASI_Mm01_00167661 predicted 2459
3 SASI_Mm01_00167662 predicted 1480
4 SASI_Mm01_00167663 predicted 2182
5 SASI_Mm01_00167664 predicted 1329
6 SASI_Mm01_00167665 predicted 3057
7 SASI_Mm01_00167666 predicted 3133
8 SASI_Mm01_00167667 predicted 2630
9 SASI_Mm01_00167668 predicted 2299
10 SASI_Mm01_00167669 predicted 514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024875
SYNPO2L MISSION shRNA Bacterial Glycerol Stock
synaptopodin 2-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024875.3-789s21c1
Sequence:CCGGCAACTACCACCTCGGTTATTTCTCGAGAAATAACCGAGGTGGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024875.3-1904s21c1
Sequence:CCGGCATCAGCCCTATCAACTTAAACTCGAGTTTAAGTTGATAGGGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024875.3-171s21c1
Sequence:CCGGAGACCAAATGCAGGACAATTGCTCGAGCAATTGTCCTGCATTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024875.3-1876s21c1
Sequence:CCGGGGGCATCAAGGCTCTAGATTTCTCGAGAAATCTAGAGCCTTGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024875.1-1740s1c1
Sequence:CCGGCTTCCTGGAAATATTCACCCACTCGAGTGGGTGAATATTTCCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024875.1-1744s1c1
Sequence:CCGGCTGGAAATATTCACCCAACATCTCGAGATGTTGGGTGAATATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024875.1-104s1c1
Sequence:CCGGCAAGACTCGTTCTATGCAGAACTCGAGTTCTGCATAGAACGAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024875.1-1903s1c1
Sequence:CCGGGCATCAGCCCTATCAACTTAACTCGAGTTAAGTTGATAGGGCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024875.1-142s1c1
Sequence:CCGGCCTCCAAGAGAAGAGCATAAACTCGAGTTTATGCTCTTCTCTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024875
SYNPO2L MISSION shRNA shRNA Plasmid DNA
synaptopodin 2-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024875.3-789s21c1
Sequence:CCGGCAACTACCACCTCGGTTATTTCTCGAGAAATAACCGAGGTGGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024875.3-1904s21c1
Sequence:CCGGCATCAGCCCTATCAACTTAAACTCGAGTTTAAGTTGATAGGGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024875.3-171s21c1
Sequence:CCGGAGACCAAATGCAGGACAATTGCTCGAGCAATTGTCCTGCATTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024875.3-1876s21c1
Sequence:CCGGGGGCATCAAGGCTCTAGATTTCTCGAGAAATCTAGAGCCTTGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024875.1-1740s1c1
Sequence:CCGGCTTCCTGGAAATATTCACCCACTCGAGTGGGTGAATATTTCCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024875.1-1744s1c1
Sequence:CCGGCTGGAAATATTCACCCAACATCTCGAGATGTTGGGTGAATATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024875.1-104s1c1
Sequence:CCGGCAAGACTCGTTCTATGCAGAACTCGAGTTCTGCATAGAACGAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024875.1-1903s1c1
Sequence:CCGGGCATCAGCCCTATCAACTTAACTCGAGTTAAGTTGATAGGGCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024875.1-142s1c1
Sequence:CCGGCCTCCAAGAGAAGAGCATAAACTCGAGTTTATGCTCTTCTCTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024875
SYNPO2L MISSION shRNA Lentiviral Transduction Particles
synaptopodin 2-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024875.3-789s21c1
Sequence:CCGGCAACTACCACCTCGGTTATTTCTCGAGAAATAACCGAGGTGGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024875.3-1904s21c1
Sequence:CCGGCATCAGCCCTATCAACTTAAACTCGAGTTTAAGTTGATAGGGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024875.3-171s21c1
Sequence:CCGGAGACCAAATGCAGGACAATTGCTCGAGCAATTGTCCTGCATTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024875.3-1876s21c1
Sequence:CCGGGGGCATCAAGGCTCTAGATTTCTCGAGAAATCTAGAGCCTTGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024875.1-1740s1c1
Sequence:CCGGCTTCCTGGAAATATTCACCCACTCGAGTGGGTGAATATTTCCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024875.1-1744s1c1
Sequence:CCGGCTGGAAATATTCACCCAACATCTCGAGATGTTGGGTGAATATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024875.1-104s1c1
Sequence:CCGGCAAGACTCGTTCTATGCAGAACTCGAGTTCTGCATAGAACGAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024875.1-1903s1c1
Sequence:CCGGGCATCAGCCCTATCAACTTAACTCGAGTTAAGTTGATAGGGCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024875.1-142s1c1
Sequence:CCGGCCTCCAAGAGAAGAGCATAAACTCGAGTTTATGCTCTTCTCTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175132
SYNPO2L MISSION shRNA Bacterial Glycerol Stock
synaptopodin 2-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175132.2-2502s1c1
Sequence:CCGGCTGGAAATACTCACCCAACATCTCGAGATGTTGGGTGAGTATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175132.2-3314s1c1
Sequence:CCGGGCAGCACTTTAGTGTTAGGTACTCGAGTACCTAACACTAAAGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175132.2-3729s1c1
Sequence:CCGGGCCTGTAGCATGTAGAGATATCTCGAGATATCTCTACATGCTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175132.2-1476s1c1
Sequence:CCGGCCCTGCACCAAGTATCTTTAACTCGAGTTAAAGATACTTGGTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175132
SYNPO2L MISSION shRNA shRNA Plasmid DNA
synaptopodin 2-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175132.2-2502s1c1
Sequence:CCGGCTGGAAATACTCACCCAACATCTCGAGATGTTGGGTGAGTATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175132.2-3314s1c1
Sequence:CCGGGCAGCACTTTAGTGTTAGGTACTCGAGTACCTAACACTAAAGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175132.2-3729s1c1
Sequence:CCGGGCCTGTAGCATGTAGAGATATCTCGAGATATCTCTACATGCTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175132.2-1476s1c1
Sequence:CCGGCCCTGCACCAAGTATCTTTAACTCGAGTTAAAGATACTTGGTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175132
SYNPO2L MISSION shRNA Lentiviral Transduction Particles
synaptopodin 2-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175132.2-2502s1c1
Sequence:CCGGCTGGAAATACTCACCCAACATCTCGAGATGTTGGGTGAGTATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175132.2-3314s1c1
Sequence:CCGGGCAGCACTTTAGTGTTAGGTACTCGAGTACCTAACACTAAAGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175132.2-3729s1c1
Sequence:CCGGGCCTGTAGCATGTAGAGATATCTCGAGATATCTCTACATGCTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175132.2-1476s1c1
Sequence:CCGGCCCTGCACCAAGTATCTTTAACTCGAGTTAAAGATACTTGGTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks