EMAIL THIS PAGE TO A FRIEND

SYNPO

synaptopodin

UniProtKB ID: Q8N3V7, A5PKZ8, D3DQG8, O15271, Q9UPX1
Gene ID:
Human(11346) Summary: Synaptopodin is an actin-associated protein that may play a role in actin-based cell shape and motility. The name synaptopodin derives from the protein's associations with postsynaptic densities and dendritic spines and with renal podocytes (Mundel et al., 1997 [PubMed 9314539]
Mouse(104027) synaptopodin
Rat(60324) synaptopodin
cow(533531) synaptopodin
sheep(101110761) synaptopodin
chicken(770421) synaptopodin
dog(479327) synaptopodin
Horse(100147046) synaptopodin
Gene Class: Cytoskeleton
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001109975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001109975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001109975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007286 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133661 MISSION® esiRNA esiRNA human SYNPO (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001109974 Rosetta Predictions human pricing
NM_007286 Rosetta Predictions human pricing
NM_021695 Rosetta Predictions rat pricing
NM_001109975 Rosetta Predictions mouse pricing
NM_177340 Rosetta Predictions mouse pricing
XM_894564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324813 predicted 1935
2 SASI_Hs02_00324814 predicted 973
3 SASI_Hs02_00324815 predicted 2010
4 SASI_Hs02_00324816 predicted 757
5 SASI_Hs02_00324817 predicted 982
6 SASI_Hs02_00324818 predicted 2200
7 SASI_Hs02_00324819 predicted 1898
8 SASI_Hs02_00324820 predicted 616
9 SASI_Hs02_00324821 predicted 1124
10 SASI_Hs02_00324822 predicted 1617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112815 predicted 1936
2 SASI_Hs01_00112816 predicted 973
3 SASI_Hs01_00112817 predicted 2014
4 SASI_Hs02_00343358 predicted 760
5 SASI_Hs01_00112818 predicted 2200
6 SASI_Hs01_00112819 predicted 1902
7 SASI_Hs01_00112820 predicted 617
8 SASI_Hs01_00112821 predicted 1124
9 SASI_Hs01_00112822 predicted 1616
10 SASI_Hs01_00112823 predicted 825
11 SASI_Hs01_00112814 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262732 predicted 603
2 SASI_Rn02_00262733 predicted 606
3 SASI_Rn01_00031126 predicted 1171
4 SASI_Rn02_00262734 predicted 1580
5 SASI_Rn01_00031127 predicted 1635
6 SASI_Rn01_00031128 predicted 779
7 SASI_Rn02_00262735 predicted 586
8 SASI_Rn01_00031129 predicted 2045
9 SASI_Rn02_00262736 predicted 619
10 SASI_Rn01_00031130 predicted 1274
11 SASI_Rn01_00031123 predicted 688
12 SASI_Rn01_00031124 predicted 1450
13 SASI_Rn01_00031125 predicted 1712
14 SASI_Rn01_00031131 predicted 1563
15 SASI_Rn01_00031132 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304484 predicted 2047
2 SASI_Mm02_00304485 predicted 1156
3 SASI_Mm02_00304486 predicted 1167
4 SASI_Mm02_00304487 predicted 771
5 SASI_Mm02_00304488 predicted 2172
6 SASI_Mm02_00304489 predicted 1874
7 SASI_Mm02_00304490 predicted 1077
8 SASI_Mm02_00304491 predicted 1904
9 SASI_Mm02_00304492 predicted 1552
10 SASI_Mm02_00304493 predicted 2140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177340 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347460 predicted 1980
2 SASI_Mm02_00347461 predicted 1101
3 SASI_Mm02_00347462 predicted 1108
4 SASI_Mm02_00347463 predicted 710
5 SASI_Mm02_00347464 predicted 2109
6 SASI_Mm02_00347465 predicted 1816
7 SASI_Mm02_00347466 predicted 1019
8 SASI_Mm02_00347467 predicted 1850
9 SASI_Mm02_00347468 predicted 1498
10 SASI_Mm02_00347469 predicted 2079
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275880 predicted 1217
2 SASI_Mm01_00275881 predicted 1230
3 SASI_Mm01_00275882 predicted 829
4 SASI_Mm01_00275883 predicted 2235
5 SASI_Mm01_00275884 predicted 452
6 SASI_Mm01_00275885 predicted 3386
7 SASI_Mm01_00275886 predicted 1965
8 SASI_Mm01_00275887 predicted 2518
9 SASI_Mm01_00275888 predicted 1617
10 SASI_Mm01_00275889 predicted 1581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001109975
SYNPO MISSION shRNA Bacterial Glycerol Stock
synaptopodin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109975.1-3659s21c1
Sequence:CCGGAGCAAGGAGACTGTCGTATAGCTCGAGCTATACGACAGTCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109975.1-595s21c1
Sequence:CCGGGGAAGTGCCATTGGTAGTTTACTCGAGTAAACTACCAATGGCACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109975.1-1155s21c1
Sequence:CCGGCCACGCCCACTAAGGTGTATACTCGAGTATACACCTTAGTGGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109975.1-1281s21c1
Sequence:CCGGTGATGGGAAGACGACAGTTTGCTCGAGCAAACTGTCGTCTTCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109975.1-741s21c1
Sequence:CCGGAGAACCCGTCCTCACCTAATGCTCGAGCATTAGGTGAGGACGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001109975
SYNPO MISSION shRNA shRNA Plasmid DNA
synaptopodin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109975.1-3659s21c1
Sequence:CCGGAGCAAGGAGACTGTCGTATAGCTCGAGCTATACGACAGTCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109975.1-595s21c1
Sequence:CCGGGGAAGTGCCATTGGTAGTTTACTCGAGTAAACTACCAATGGCACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109975.1-1155s21c1
Sequence:CCGGCCACGCCCACTAAGGTGTATACTCGAGTATACACCTTAGTGGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109975.1-1281s21c1
Sequence:CCGGTGATGGGAAGACGACAGTTTGCTCGAGCAAACTGTCGTCTTCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109975.1-741s21c1
Sequence:CCGGAGAACCCGTCCTCACCTAATGCTCGAGCATTAGGTGAGGACGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001109975
SYNPO MISSION shRNA Lentiviral Transduction Particles
synaptopodin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109975.1-3659s21c1
Sequence:CCGGAGCAAGGAGACTGTCGTATAGCTCGAGCTATACGACAGTCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109975.1-595s21c1
Sequence:CCGGGGAAGTGCCATTGGTAGTTTACTCGAGTAAACTACCAATGGCACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109975.1-1155s21c1
Sequence:CCGGCCACGCCCACTAAGGTGTATACTCGAGTATACACCTTAGTGGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109975.1-1281s21c1
Sequence:CCGGTGATGGGAAGACGACAGTTTGCTCGAGCAAACTGTCGTCTTCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109975.1-741s21c1
Sequence:CCGGAGAACCCGTCCTCACCTAATGCTCGAGCATTAGGTGAGGACGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007286
SYNPO MISSION shRNA Bacterial Glycerol Stock
synaptopodin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007286.4-1303s21c1
Sequence:CCGGCATGCTAGAGAGACGACATTTCTCGAGAAATGTCGTCTCTCTAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007286.4-1531s21c1
Sequence:CCGGGAGGTCTCCTCCCTCATATTCCTCGAGGAATATGAGGGAGGAGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007286.4-4225s21c1
Sequence:GTACCGGAGTTACTTGTTACGGGAAATACTCGAGTATTTCCCGTAACAAGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007286.4-601s21c1
Sequence:GTACCGGACCACTGGTGGTTTATCTAAACTCGAGTTTAGATAAACCACCAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007286.4-1375s21c1
Sequence:CCGGCCGGCCACAGAGACACATAATCTCGAGATTATGTGTCTCTGTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007286.3-3254s1c1
Sequence:CCGGGAGCCAGAAGAAGGCTCATTACTCGAGTAATGAGCCTTCTTCTGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007286.3-1637s1c1
Sequence:CCGGCCGCAAATCCATGTTTACTTTCTCGAGAAAGTAAACATGGATTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007286.3-970s1c1
Sequence:CCGGCACTCCTAATTGACAAGGTATCTCGAGATACCTTGTCAATTAGGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007286.3-2778s1c1
Sequence:CCGGCTGGCGCGAAACATCATCAATCTCGAGATTGATGATGTTTCGCGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007286.3-1521s1c1
Sequence:CCGGCCCTCATATTCTGTCCTGTATCTCGAGATACAGGACAGAATATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007286
SYNPO MISSION shRNA shRNA Plasmid DNA
synaptopodin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007286.4-1303s21c1
Sequence:CCGGCATGCTAGAGAGACGACATTTCTCGAGAAATGTCGTCTCTCTAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007286.4-1531s21c1
Sequence:CCGGGAGGTCTCCTCCCTCATATTCCTCGAGGAATATGAGGGAGGAGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007286.4-4225s21c1
Sequence:GTACCGGAGTTACTTGTTACGGGAAATACTCGAGTATTTCCCGTAACAAGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007286.4-601s21c1
Sequence:GTACCGGACCACTGGTGGTTTATCTAAACTCGAGTTTAGATAAACCACCAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007286.4-1375s21c1
Sequence:CCGGCCGGCCACAGAGACACATAATCTCGAGATTATGTGTCTCTGTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007286.3-3254s1c1
Sequence:CCGGGAGCCAGAAGAAGGCTCATTACTCGAGTAATGAGCCTTCTTCTGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007286.3-1637s1c1
Sequence:CCGGCCGCAAATCCATGTTTACTTTCTCGAGAAAGTAAACATGGATTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007286.3-970s1c1
Sequence:CCGGCACTCCTAATTGACAAGGTATCTCGAGATACCTTGTCAATTAGGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007286.3-2778s1c1
Sequence:CCGGCTGGCGCGAAACATCATCAATCTCGAGATTGATGATGTTTCGCGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007286.3-1521s1c1
Sequence:CCGGCCCTCATATTCTGTCCTGTATCTCGAGATACAGGACAGAATATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007286
SYNPO MISSION shRNA Lentiviral Transduction Particles
synaptopodin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007286.4-1303s21c1
Sequence:CCGGCATGCTAGAGAGACGACATTTCTCGAGAAATGTCGTCTCTCTAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007286.4-1531s21c1
Sequence:CCGGGAGGTCTCCTCCCTCATATTCCTCGAGGAATATGAGGGAGGAGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007286.4-4225s21c1
Sequence:GTACCGGAGTTACTTGTTACGGGAAATACTCGAGTATTTCCCGTAACAAGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007286.4-601s21c1
Sequence:GTACCGGACCACTGGTGGTTTATCTAAACTCGAGTTTAGATAAACCACCAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007286.4-1375s21c1
Sequence:CCGGCCGGCCACAGAGACACATAATCTCGAGATTATGTGTCTCTGTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007286.3-3254s1c1
Sequence:CCGGGAGCCAGAAGAAGGCTCATTACTCGAGTAATGAGCCTTCTTCTGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007286.3-1637s1c1
Sequence:CCGGCCGCAAATCCATGTTTACTTTCTCGAGAAAGTAAACATGGATTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007286.3-970s1c1
Sequence:CCGGCACTCCTAATTGACAAGGTATCTCGAGATACCTTGTCAATTAGGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007286.3-2778s1c1
Sequence:CCGGCTGGCGCGAAACATCATCAATCTCGAGATTGATGATGTTTCGCGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007286.3-1521s1c1
Sequence:CCGGCCCTCATATTCTGTCCTGTATCTCGAGATACAGGACAGAATATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks