EMAIL THIS PAGE TO A FRIEND

SYNPR

synaptoporin

Synonyms: SPO
UniProtKB ID: Q8TBG9, B2R675, G5E9W4
Gene ID:
Mouse(72003) synaptoporin
Rat(66030) synaptoporin
Zebrafish(368919) synaptoporin
chicken(396359) synaptoporin
dog(484704) synaptoporin
cow(613433) synaptoporin
sheep(101120023) synaptoporin
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144642 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028052 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028052 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028052 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143011 MISSION® esiRNA esiRNA human SYNPR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144642 Rosetta Predictions human pricing
NM_023974 Rosetta Predictions rat pricing
NM_028052 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121436 predicted 551
2 SASI_Hs02_00364491 predicted 967
3 SASI_Hs02_00364492 predicted 559
4 SASI_Hs01_00121437 predicted 755
5 SASI_Hs02_00364493 predicted 988
6 SASI_Hs01_00121440 predicted 831
7 SASI_Hs01_00121442 predicted 538
8 SASI_Hs01_00121443 predicted 899
9 SASI_Hs01_00121444 predicted 886
10 SASI_Hs02_00364494 predicted 870
11 SASI_Hs01_00121438 predicted 444
12 SASI_Hs01_00121439 predicted 675
13 SASI_Hs01_00121441 predicted 794
14 SASI_Hs01_00121445 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032360 predicted 1057
2 SASI_Rn01_00032361 predicted 602
3 SASI_Rn01_00032362 predicted 695
4 SASI_Rn01_00032364 predicted 833
5 SASI_Rn02_00263793 predicted 1142
6 SASI_Rn01_00032365 predicted 729
7 SASI_Rn01_00032367 predicted 418
8 SASI_Rn01_00032368 predicted 793
9 SASI_Rn02_00263794 predicted 514
10 SASI_Rn01_00032369 predicted 1130
11 SASI_Rn01_00032363 predicted 999
12 SASI_Rn01_00032366 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110327 predicted 1128
2 SASI_Mm01_00110328 predicted 1034
3 SASI_Mm01_00110329 predicted 829
4 SASI_Mm01_00110330 predicted 773
5 SASI_Mm01_00110331 predicted 792
6 SASI_Mm01_00110332 predicted 602
7 SASI_Mm01_00110333 predicted 923
8 SASI_Mm01_00110334 predicted 364
9 SASI_Mm01_00110336 predicted 733
10 SASI_Mm02_00333244 predicted 351
11 SASI_Mm01_00110335 predicted 1141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144642
SYNPR MISSION shRNA Bacterial Glycerol Stock
synaptoporin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-213s1c1
Sequence:CCGGCTCAGCATCGACATAGCGTTTCTCGAGAAACGCTATGTCGATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-791s1c1
Sequence:CCGGCTATGGATCAAGCAGTGGGTACTCGAGTACCCACTGCTTGATCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-656s1c1
Sequence:CCGGCTTTATTCTCTGGGCTGGAAACTCGAGTTTCCAGCCCAGAGAATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-540s1c1
Sequence:CCGGCCCAAGGAAGTATTGCTACTACTCGAGTAGTAGCAATACTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-757s1c1
Sequence:CCGGGCAGCTATAATCAAGGTGGTTCTCGAGAACCACCTTGATTATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144642.4-1367s21c1
Sequence:CCGGATTCATCATAGATGGCTAATTCTCGAGAATTAGCCATCTATGATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144642.4-1625s21c1
Sequence:CCGGCTATGAGTCTCTAAGTTATTTCTCGAGAAATAACTTAGAGACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144642.4-413s21c1
Sequence:CCGGTTGCAACATGCGGTGGCTATTCTCGAGAATAGCCACCGCATGTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144642.4-1345s21c1
Sequence:CCGGAGGCGACATGAGGAGATATATCTCGAGATATATCTCCTCATGTCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144642
SYNPR MISSION shRNA shRNA Plasmid DNA
synaptoporin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-213s1c1
Sequence:CCGGCTCAGCATCGACATAGCGTTTCTCGAGAAACGCTATGTCGATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-791s1c1
Sequence:CCGGCTATGGATCAAGCAGTGGGTACTCGAGTACCCACTGCTTGATCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-656s1c1
Sequence:CCGGCTTTATTCTCTGGGCTGGAAACTCGAGTTTCCAGCCCAGAGAATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-540s1c1
Sequence:CCGGCCCAAGGAAGTATTGCTACTACTCGAGTAGTAGCAATACTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-757s1c1
Sequence:CCGGGCAGCTATAATCAAGGTGGTTCTCGAGAACCACCTTGATTATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144642.4-1367s21c1
Sequence:CCGGATTCATCATAGATGGCTAATTCTCGAGAATTAGCCATCTATGATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144642.4-1625s21c1
Sequence:CCGGCTATGAGTCTCTAAGTTATTTCTCGAGAAATAACTTAGAGACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144642.4-413s21c1
Sequence:CCGGTTGCAACATGCGGTGGCTATTCTCGAGAATAGCCACCGCATGTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144642.4-1345s21c1
Sequence:CCGGAGGCGACATGAGGAGATATATCTCGAGATATATCTCCTCATGTCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144642
SYNPR MISSION shRNA Lentiviral Transduction Particles
synaptoporin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-213s1c1
Sequence:CCGGCTCAGCATCGACATAGCGTTTCTCGAGAAACGCTATGTCGATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-791s1c1
Sequence:CCGGCTATGGATCAAGCAGTGGGTACTCGAGTACCCACTGCTTGATCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-656s1c1
Sequence:CCGGCTTTATTCTCTGGGCTGGAAACTCGAGTTTCCAGCCCAGAGAATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-540s1c1
Sequence:CCGGCCCAAGGAAGTATTGCTACTACTCGAGTAGTAGCAATACTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144642.3-757s1c1
Sequence:CCGGGCAGCTATAATCAAGGTGGTTCTCGAGAACCACCTTGATTATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144642.4-1367s21c1
Sequence:CCGGATTCATCATAGATGGCTAATTCTCGAGAATTAGCCATCTATGATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144642.4-1625s21c1
Sequence:CCGGCTATGAGTCTCTAAGTTATTTCTCGAGAAATAACTTAGAGACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144642.4-413s21c1
Sequence:CCGGTTGCAACATGCGGTGGCTATTCTCGAGAATAGCCACCGCATGTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144642.4-1345s21c1
Sequence:CCGGAGGCGACATGAGGAGATATATCTCGAGATATATCTCCTCATGTCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028052
SYNPR MISSION shRNA Bacterial Glycerol Stock
synaptoporin
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000093204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028052.2-1621s1c1
Sequence:CCGGGCTGTATTTCTGGAGACATTTCTCGAGAAATGTCTCCAGAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028052.2-381s1c1
Sequence:CCGGCTCAGCATTGACATAGCGTTTCTCGAGAAACGCTATGTCAATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028052.2-880s1c1
Sequence:CCGGCCTCTGGACAGAGATACCTTTCTCGAGAAAGGTATCTCTGTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028052.2-391s1c1
Sequence:CCGGACATAGCGTTTGCGTACCCATCTCGAGATGGGTACGCAAACGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028052
SYNPR MISSION shRNA shRNA Plasmid DNA
synaptoporin
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000093204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028052.2-1621s1c1
Sequence:CCGGGCTGTATTTCTGGAGACATTTCTCGAGAAATGTCTCCAGAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028052.2-381s1c1
Sequence:CCGGCTCAGCATTGACATAGCGTTTCTCGAGAAACGCTATGTCAATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028052.2-880s1c1
Sequence:CCGGCCTCTGGACAGAGATACCTTTCTCGAGAAAGGTATCTCTGTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028052.2-391s1c1
Sequence:CCGGACATAGCGTTTGCGTACCCATCTCGAGATGGGTACGCAAACGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028052
SYNPR MISSION shRNA Lentiviral Transduction Particles
synaptoporin
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000093204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028052.2-1621s1c1
Sequence:CCGGGCTGTATTTCTGGAGACATTTCTCGAGAAATGTCTCCAGAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028052.2-381s1c1
Sequence:CCGGCTCAGCATTGACATAGCGTTTCTCGAGAAACGCTATGTCAATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028052.2-880s1c1
Sequence:CCGGCCTCTGGACAGAGATACCTTTCTCGAGAAAGGTATCTCTGTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028052.2-391s1c1
Sequence:CCGGACATAGCGTTTGCGTACCCATCTCGAGATGGGTACGCAAACGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks