EMAIL THIS PAGE TO A FRIEND

SYNRG

synergin, gamma

Synonyms: AP1GBP1 SYNG
UniProtKB ID: Q9UMZ2, B7ZKZ2, B7ZKZ3, Q17RI2, Q5BKU5, Q6ZT17
Gene ID:
Human(11276) Summary: This gene encodes a protein that interacts with the gamma subunit of AP1 clathrin-adaptor complex. The AP1 complex is located at the trans-Golgi network and associates specific proteins with clathrin-coated vesicles. This encoded protein may act to connect the AP1 complex to other proteins. Alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(217030) synergin, gamma
Rat(84479) synergin, gamma
Zebrafish(555257) synergin, gamma
chicken(417658) synergin, gamma
dog(480597) synergin, gamma
domestic cat(101082532) synergin, gamma
Horse(100071490) synergin, gamma
cow(533098) synergin, gamma
sheep(101110252) synergin, gamma
naked mole-rat(101709854) synergin, gamma
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007247 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_194341 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194341 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194341 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007247 Rosetta Predictions human pricing
NM_080550 Rosetta Predictions human pricing
NM_053419 Rosetta Predictions rat pricing
NM_001115009 Rosetta Predictions mouse pricing
NM_194341 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190237 predicted 1871
2 SASI_Hs01_00190238 predicted 2370
3 SASI_Hs01_00190239 predicted 204
4 SASI_Hs01_00190240 predicted 1780
5 SASI_Hs01_00190242 predicted 1550
6 SASI_Hs01_00190243 predicted 1151
7 SASI_Hs01_00190244 predicted 756
8 SASI_Hs01_00190245 predicted 651
9 SASI_Hs02_00343268 predicted 3407
10 SASI_Hs01_00190246 predicted 2263
11 SASI_Hs01_00190241 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242344 predicted 1873
2 SASI_Hs01_00242345 predicted 2363
3 SASI_Hs01_00242346 predicted 209
4 SASI_Hs01_00242347 predicted 1782
5 SASI_Hs01_00242349 predicted 1549
6 SASI_Hs01_00242350 predicted 1144
7 SASI_Hs01_00242351 predicted 755
8 SASI_Hs01_00242352 predicted 645
9 SASI_Hs02_00362312 predicted 3413
10 SASI_Hs01_00242353 predicted 2270
11 SASI_Hs01_00242348 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265951 predicted 1246
2 SASI_Rn02_00265952 predicted 2111
3 SASI_Rn02_00265953 predicted 1215
4 SASI_Rn02_00265954 predicted 3666
5 SASI_Rn02_00265955 predicted 1559
6 SASI_Rn02_00265956 predicted 2858
7 SASI_Rn02_00265957 predicted 2496
8 SASI_Rn02_00265958 predicted 2658
9 SASI_Rn02_00265959 predicted 1549
10 SASI_Rn02_00265960 predicted 3703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308857 predicted 3088
2 SASI_Mm02_00308858 predicted 3139
3 SASI_Mm02_00308859 predicted 2311
4 SASI_Mm02_00308860 predicted 1399
5 SASI_Mm02_00308861 predicted 1740
6 SASI_Mm02_00308862 predicted 3481
7 SASI_Mm02_00308863 predicted 1194
8 SASI_Mm02_00308864 predicted 3124
9 SASI_Mm02_00308865 predicted 1931
10 SASI_Mm02_00308866 predicted 1496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350622 predicted 2579
2 SASI_Mm02_00350623 predicted 2629
3 SASI_Mm02_00350624 predicted 2030
4 SASI_Mm02_00350625 predicted 1116
5 SASI_Mm01_00145098 predicted 1461
6 SASI_Mm01_00145101 predicted 2978
7 SASI_Mm01_00145102 predicted 913
8 SASI_Mm01_00145104 predicted 2610
9 SASI_Mm02_00350626 predicted 1647
10 SASI_Mm02_00350627 predicted 1213
11 SASI_Mm01_00145096 predicted 621
12 SASI_Mm01_00145097 predicted 3141
13 SASI_Mm01_00145099 predicted 785
14 SASI_Mm01_00145100 predicted 720
15 SASI_Mm01_00145103 predicted 2509
16 SASI_Mm01_00145105 predicted 3183
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007247
VALIDATED
SYNRG MISSION shRNA Bacterial Glycerol Stock
synergin, gamma
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007247.4-4280s21c1
Sequence:CCGGCCACGGCTTTCTTGATCTAAGCTCGAGCTTAGATCAAGAAAGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007247.4-242s21c1
Sequence:CCGGCTCTGTCATGCAGCCTAATATCTCGAGATATTAGGCTGCATGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007247.4-975s21c1
Sequence:CCGGTTGGTTCCAGATGCCTATAAGCTCGAGCTTATAGGCATCTGGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007247.4-4119s21c1
Sequence:CCGGTTCGCTTCCCTGAATCGATATCTCGAGATATCGATTCAGGGAAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007247.4-1919s21c1
Sequence:CCGGGAACTTAGCAGACCTAGATATCTCGAGATATCTAGGTCTGCTAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007247.4-3685s21c1
Sequence:CCGGTGCTGAAGGACATCGATAAAGCTCGAGCTTTATCGATGTCCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_007247.3-3320s1c1
Sequence:CCGGCCTTTCAGAGACCGTTCCAATCTCGAGATTGGAACGGTCTCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007247.3-1348s1c1
Sequence:CCGGCCAGGCTTCTAGTGGTTTCATCTCGAGATGAAACCACTAGAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007247.3-211s1c1
Sequence:CCGGGCAGCCTAATATGCAAGGCATCTCGAGATGCCTTGCATATTAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007247.3-1769s1c1
Sequence:CCGGGCCGATAGTGTATCACCACTACTCGAGTAGTGGTGATACACTATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007247.3-1920s1c1
Sequence:CCGGGCAGCGAGAAACCATTGTCTTCTCGAGAAGACAATGGTTTCTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007247
VALIDATED
SYNRG MISSION shRNA shRNA Plasmid DNA
synergin, gamma
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007247.4-4280s21c1
Sequence:CCGGCCACGGCTTTCTTGATCTAAGCTCGAGCTTAGATCAAGAAAGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007247.4-242s21c1
Sequence:CCGGCTCTGTCATGCAGCCTAATATCTCGAGATATTAGGCTGCATGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007247.4-975s21c1
Sequence:CCGGTTGGTTCCAGATGCCTATAAGCTCGAGCTTATAGGCATCTGGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007247.4-4119s21c1
Sequence:CCGGTTCGCTTCCCTGAATCGATATCTCGAGATATCGATTCAGGGAAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007247.4-1919s21c1
Sequence:CCGGGAACTTAGCAGACCTAGATATCTCGAGATATCTAGGTCTGCTAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007247.4-3685s21c1
Sequence:CCGGTGCTGAAGGACATCGATAAAGCTCGAGCTTTATCGATGTCCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_007247.3-3320s1c1
Sequence:CCGGCCTTTCAGAGACCGTTCCAATCTCGAGATTGGAACGGTCTCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007247.3-1348s1c1
Sequence:CCGGCCAGGCTTCTAGTGGTTTCATCTCGAGATGAAACCACTAGAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007247.3-211s1c1
Sequence:CCGGGCAGCCTAATATGCAAGGCATCTCGAGATGCCTTGCATATTAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007247.3-1769s1c1
Sequence:CCGGGCCGATAGTGTATCACCACTACTCGAGTAGTGGTGATACACTATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007247.3-1920s1c1
Sequence:CCGGGCAGCGAGAAACCATTGTCTTCTCGAGAAGACAATGGTTTCTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007247
VALIDATED
SYNRG MISSION shRNA Lentiviral Transduction Particles
synergin, gamma
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007247.4-4280s21c1
Sequence:CCGGCCACGGCTTTCTTGATCTAAGCTCGAGCTTAGATCAAGAAAGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007247.4-242s21c1
Sequence:CCGGCTCTGTCATGCAGCCTAATATCTCGAGATATTAGGCTGCATGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007247.4-975s21c1
Sequence:CCGGTTGGTTCCAGATGCCTATAAGCTCGAGCTTATAGGCATCTGGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007247.4-4119s21c1
Sequence:CCGGTTCGCTTCCCTGAATCGATATCTCGAGATATCGATTCAGGGAAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007247.4-1919s21c1
Sequence:CCGGGAACTTAGCAGACCTAGATATCTCGAGATATCTAGGTCTGCTAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007247.4-3685s21c1
Sequence:CCGGTGCTGAAGGACATCGATAAAGCTCGAGCTTTATCGATGTCCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_007247.3-3320s1c1
Sequence:CCGGCCTTTCAGAGACCGTTCCAATCTCGAGATTGGAACGGTCTCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007247.3-1348s1c1
Sequence:CCGGCCAGGCTTCTAGTGGTTTCATCTCGAGATGAAACCACTAGAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007247.3-211s1c1
Sequence:CCGGGCAGCCTAATATGCAAGGCATCTCGAGATGCCTTGCATATTAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007247.3-1769s1c1
Sequence:CCGGGCCGATAGTGTATCACCACTACTCGAGTAGTGGTGATACACTATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007247.3-1920s1c1
Sequence:CCGGGCAGCGAGAAACCATTGTCTTCTCGAGAAGACAATGGTTTCTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194341
VALIDATED
SYNRG MISSION shRNA Bacterial Glycerol Stock
synergin, gamma
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_194341.1-3881s1c1
Sequence:CCGGGCTGCTGAAGTGTATGTGAAACTCGAGTTTCACATACACTTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_194341.1-1853s1c1
Sequence:CCGGCTCCATTTCATCTGAGCCAAACTCGAGTTTGGCTCAGATGAAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194341.1-1852s1c1
Sequence:CCGGGCTCCATTTCATCTGAGCCAACTCGAGTTGGCTCAGATGAAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_194341.1-2574s1c1
Sequence:CCGGGCAGACGACTTTGGAGAATTTCTCGAGAAATTCTCCAAAGTCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_194341.1-1391s1c1
Sequence:CCGGCGAGCAAACGACAGACAGTAACTCGAGTTACTGTCTGTCGTTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194341
VALIDATED
SYNRG MISSION shRNA shRNA Plasmid DNA
synergin, gamma
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_194341.1-3881s1c1
Sequence:CCGGGCTGCTGAAGTGTATGTGAAACTCGAGTTTCACATACACTTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_194341.1-1853s1c1
Sequence:CCGGCTCCATTTCATCTGAGCCAAACTCGAGTTTGGCTCAGATGAAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194341.1-1852s1c1
Sequence:CCGGGCTCCATTTCATCTGAGCCAACTCGAGTTGGCTCAGATGAAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_194341.1-2574s1c1
Sequence:CCGGGCAGACGACTTTGGAGAATTTCTCGAGAAATTCTCCAAAGTCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_194341.1-1391s1c1
Sequence:CCGGCGAGCAAACGACAGACAGTAACTCGAGTTACTGTCTGTCGTTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194341
VALIDATED
SYNRG MISSION shRNA Lentiviral Transduction Particles
synergin, gamma
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_194341.1-3881s1c1
Sequence:CCGGGCTGCTGAAGTGTATGTGAAACTCGAGTTTCACATACACTTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_194341.1-1853s1c1
Sequence:CCGGCTCCATTTCATCTGAGCCAAACTCGAGTTTGGCTCAGATGAAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194341.1-1852s1c1
Sequence:CCGGGCTCCATTTCATCTGAGCCAACTCGAGTTGGCTCAGATGAAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_194341.1-2574s1c1
Sequence:CCGGGCAGACGACTTTGGAGAATTTCTCGAGAAATTCTCCAAAGTCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_194341.1-1391s1c1
Sequence:CCGGCGAGCAAACGACAGACAGTAACTCGAGTTACTGTCTGTCGTTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks