EMAIL THIS PAGE TO A FRIEND

SYP

synaptophysin

Synonyms: MRXSYP
UniProtKB ID: P08247, B2R7L6, Q6P2F7
Gene ID:
Human(6855) Summary: This gene encodes an integral membrane protein of small synaptic vesicles in brain and endocrine cells. The protein also binds cholesterol and is thought to direct targeting of vesicle-associated membrane protein 2 (synaptobrevin) to intracellular compartments. Mutations in this gene are associated with X-linked mental retardation (XLMR). [provided by RefSeq, Aug 2011]
Mouse(20977) synaptophysin
Rat(24804) synaptophysin
dog(612557) synaptophysin
domestic cat(101084343) synaptophysin
cow(280937) synaptophysin
sheep(101112034) synaptophysin
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003179 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AB9272 Anti-Synaptophysin Antibody 500 µL, Anti-Synaptophysin Antibody detects level of Synaptophysin & has been published & validated for use in WB, IH(P). pricing
MABN1193 Anti-Synaptophysin Antibody, clone 10F6.1 50 µL, Anti-Synaptophysin Antibody, clone 10F6.1, Cat. No. MABN1193, is a highly specific monoclonal antibody that targets Synaptophysin and has been tested in Immunohistochemistry (Paraffin) and Western Blotting. pricing
MAB329 Anti-Synaptophysin Antibody, clone SP15 100 µL, This Anti-Synaptophysin Antibody, clone SP15 is validated for use in ELISA, WB, IH(P) for the detection of Synaptophysin. pricing
MAB5258-20UG Anti-Synaptophysin Antibody, clone SY38 20 µg, Detect Synaptophysin using this Anti-Synaptophysin Antibody, clone SY38 validated for use in FC, IC, IH & WB. pricing
MAB5258-50UG Anti-Synaptophysin Antibody, clone SY38 50 µg, Anti-Synaptophysin Antibody, clone SY38 detects level of Synaptophysin & has been published & validated for use in WB, IC, IH. pricing
MAB5258-I Anti-Synaptophysin Antibody, clone SY38 100 µL, Anti-Synaptophysin, clone SY38, Cat. No. MAB5258-I, is a highly specific mouse monoclonal antibody that targets Synaptophysin and has been tested in Immunocytochemistry, Immunofluorescence, Immunohistochemistry, and Western Blotting. pricing
MAB5258A4 Anti-Synaptophysin Antibody, clone SY38, Alexa Fluor® 488 Conjugate | MAB5258A4 100 µL pricing
MAB5258-AF555 Anti-Synaptophysin Antibody, clone SY38, AlexaFluor® 555 Conjugate 100 µL, This Anti-Synaptophysin Antibody, clone SY38, AlexaFluor® 555 Conjugate is validated for use in Immunocytochemistry for the detection of Synaptophysin. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003179 Rosetta Predictions human pricing
NM_012664 Rosetta Predictions rat pricing
NM_009305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030359 predicted 594
2 SASI_Hs01_00030360 predicted 473
3 SASI_Hs01_00030361 predicted 280
4 SASI_Hs01_00030363 predicted 663
5 SASI_Hs01_00030364 predicted 314
6 SASI_Hs01_00030365 predicted 249
7 SASI_Hs01_00030366 predicted 393
8 SASI_Hs01_00030367 predicted 203
9 SASI_Hs02_00335204 predicted 204
10 SASI_Hs01_00030368 predicted 525
11 SASI_Hs01_00030362 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081976 predicted 441
2 SASI_Rn02_00259922 predicted 191
3 SASI_Rn01_00081978 predicted 492
4 SASI_Rn02_00259923 predicted 421
5 SASI_Rn01_00081979 predicted 1400
6 SASI_Rn01_00081980 predicted 603
7 SASI_Rn01_00081981 predicted 466
8 SASI_Rn01_00081982 predicted 1425
9 SASI_Rn01_00081983 predicted 657
10 SASI_Rn01_00081984 predicted 252
11 SASI_Rn01_00081975 predicted 599
12 SASI_Rn01_00081977 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188409 predicted 1487
2 SASI_Mm02_00315839 predicted 299
3 SASI_Mm01_00188410 predicted 354
4 SASI_Mm01_00188411 predicted 559
5 SASI_Mm01_00188412 predicted 341
6 SASI_Mm01_00188413 predicted 379
7 SASI_Mm01_00188414 predicted 652
8 SASI_Mm01_00188415 predicted 835
9 SASI_Mm01_00188416 predicted 575
10 SASI_Mm01_00188417 predicted 714
11 SASI_Mm01_00188418 predicted 500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003179
SYP MISSION shRNA Bacterial Glycerol Stock
synaptophysin
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-384s1c1
Sequence:CCGGGCAGAACAAGTACCGAGAGAACTCGAGTTCTCTCGGTACTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-519s1c1
Sequence:CCGGAGAGAACATTATCAAGGAGATCTCGAGATCTCCTTGATAATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-229s1c1
Sequence:CCGGCTGCACCAAGTGTACTTTGATCTCGAGATCAAAGTACACTTGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-918s1c1
Sequence:CCGGCACCTCCTTCTCCAATCAGATCTCGAGATCTGATTGGAGAAGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-651s1c1
Sequence:CCGGCAACCTGTGGTTCGTGTTTAACTCGAGTTAAACACGAACCACAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-285s21c1
Sequence:GTACCGGGCACCACCAAGGTCTTCTTAGCTCGAGCTAAGAAGACCTTGGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003179.2-1376s21c1
Sequence:GTACCGGGCAATGCCTGCCTGAACAAAGCTCGAGCTTTGTTCAGGCAGGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-666s21c1
Sequence:GTACCGGGCAACCTGTGGTTCGTGTTTACTCGAGTAAACACGAACCACAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-408s21c1
Sequence:GTACCGGAGTACCGAGAGAATAACAAAGCTCGAGCTTTGTTATTCTCTCGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-97s21c1
Sequence:GTACCGGCTTTGTGAAGGTGCTGCAATGCTCGAGCATTGCAGCACCTTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-527s21c1
Sequence:GTACCGGACAGACCCAGAGAACATTATCCTCGAGGATAATGTTCTCTGGGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003179.2-1406s21c1
Sequence:GTACCGGGAAATCCAACTCCAGGGTTAACTCGAGTTAACCCTGGAGTTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003179
SYP MISSION shRNA shRNA Plasmid DNA
synaptophysin
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-384s1c1
Sequence:CCGGGCAGAACAAGTACCGAGAGAACTCGAGTTCTCTCGGTACTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-519s1c1
Sequence:CCGGAGAGAACATTATCAAGGAGATCTCGAGATCTCCTTGATAATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-229s1c1
Sequence:CCGGCTGCACCAAGTGTACTTTGATCTCGAGATCAAAGTACACTTGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-918s1c1
Sequence:CCGGCACCTCCTTCTCCAATCAGATCTCGAGATCTGATTGGAGAAGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-651s1c1
Sequence:CCGGCAACCTGTGGTTCGTGTTTAACTCGAGTTAAACACGAACCACAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-285s21c1
Sequence:GTACCGGGCACCACCAAGGTCTTCTTAGCTCGAGCTAAGAAGACCTTGGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003179.2-1376s21c1
Sequence:GTACCGGGCAATGCCTGCCTGAACAAAGCTCGAGCTTTGTTCAGGCAGGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-666s21c1
Sequence:GTACCGGGCAACCTGTGGTTCGTGTTTACTCGAGTAAACACGAACCACAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-408s21c1
Sequence:GTACCGGAGTACCGAGAGAATAACAAAGCTCGAGCTTTGTTATTCTCTCGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-97s21c1
Sequence:GTACCGGCTTTGTGAAGGTGCTGCAATGCTCGAGCATTGCAGCACCTTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-527s21c1
Sequence:GTACCGGACAGACCCAGAGAACATTATCCTCGAGGATAATGTTCTCTGGGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003179.2-1406s21c1
Sequence:GTACCGGGAAATCCAACTCCAGGGTTAACTCGAGTTAACCCTGGAGTTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003179
SYP MISSION shRNA Lentiviral Transduction Particles
synaptophysin
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-384s1c1
Sequence:CCGGGCAGAACAAGTACCGAGAGAACTCGAGTTCTCTCGGTACTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-519s1c1
Sequence:CCGGAGAGAACATTATCAAGGAGATCTCGAGATCTCCTTGATAATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-229s1c1
Sequence:CCGGCTGCACCAAGTGTACTTTGATCTCGAGATCAAAGTACACTTGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-918s1c1
Sequence:CCGGCACCTCCTTCTCCAATCAGATCTCGAGATCTGATTGGAGAAGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-651s1c1
Sequence:CCGGCAACCTGTGGTTCGTGTTTAACTCGAGTTAAACACGAACCACAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-285s21c1
Sequence:GTACCGGGCACCACCAAGGTCTTCTTAGCTCGAGCTAAGAAGACCTTGGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003179.2-1376s21c1
Sequence:GTACCGGGCAATGCCTGCCTGAACAAAGCTCGAGCTTTGTTCAGGCAGGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-666s21c1
Sequence:GTACCGGGCAACCTGTGGTTCGTGTTTACTCGAGTAAACACGAACCACAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-408s21c1
Sequence:GTACCGGAGTACCGAGAGAATAACAAAGCTCGAGCTTTGTTATTCTCTCGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-97s21c1
Sequence:GTACCGGCTTTGTGAAGGTGCTGCAATGCTCGAGCATTGCAGCACCTTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-527s21c1
Sequence:GTACCGGACAGACCCAGAGAACATTATCCTCGAGGATAATGTTCTCTGGGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003179.2-1406s21c1
Sequence:GTACCGGGAAATCCAACTCCAGGGTTAACTCGAGTTAACCCTGGAGTTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009305
SYP MISSION shRNA Bacterial Glycerol Stock
synaptophysin
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-175s1c1
Sequence:CCGGCTCAACATCGAAGTCGAATTTCTCGAGAAATTCGACTTCGATGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-797s1c1
Sequence:CCGGAGGGTGGTTATCAACCCGATTCTCGAGAATCGGGTTGATAACCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-173s1c1
Sequence:CCGGCCCTCAACATCGAAGTCGAATCTCGAGATTCGACTTCGATGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009305.1-1831s1c1
Sequence:CCGGCGGTTTCAGTTGAGTGGAGTTCTCGAGAACTCCACTCAACTGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-537s1c1
Sequence:CCGGCCAGACAGGAAACACATGCAACTCGAGTTGCATGTGTTTCCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-1039s21c1
Sequence:GTACCGGCCTTCTCCAATCAGATGTAATCTCGAGATTACATCTGATTGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-307s21c1
Sequence:GTACCGGTCAACATCGAAGTCGAATTTGCTCGAGCAAATTCGACTTCGATGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-359s21c1
Sequence:GTACCGGTGATGCACCCTCCTGCGTTAACTCGAGTTAACGCAGGAGGGTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-412s21c1
Sequence:GTACCGGACTACTCCTCCTCGGCTGAATCTCGAGATTCAGCCGAGGAGGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-930s21c1
Sequence:GTACCGGGGTGGTTATCAACCCGATTACCTCGAGGTAATCGGGTTGATAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-625s21c1
Sequence:GTACCGGCCACTGACCCAGAGAACATTACTCGAGTAATGTTCTCTGGGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009305
SYP MISSION shRNA shRNA Plasmid DNA
synaptophysin
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-175s1c1
Sequence:CCGGCTCAACATCGAAGTCGAATTTCTCGAGAAATTCGACTTCGATGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-797s1c1
Sequence:CCGGAGGGTGGTTATCAACCCGATTCTCGAGAATCGGGTTGATAACCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-173s1c1
Sequence:CCGGCCCTCAACATCGAAGTCGAATCTCGAGATTCGACTTCGATGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009305.1-1831s1c1
Sequence:CCGGCGGTTTCAGTTGAGTGGAGTTCTCGAGAACTCCACTCAACTGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-537s1c1
Sequence:CCGGCCAGACAGGAAACACATGCAACTCGAGTTGCATGTGTTTCCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-1039s21c1
Sequence:GTACCGGCCTTCTCCAATCAGATGTAATCTCGAGATTACATCTGATTGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-307s21c1
Sequence:GTACCGGTCAACATCGAAGTCGAATTTGCTCGAGCAAATTCGACTTCGATGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-359s21c1
Sequence:GTACCGGTGATGCACCCTCCTGCGTTAACTCGAGTTAACGCAGGAGGGTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-412s21c1
Sequence:GTACCGGACTACTCCTCCTCGGCTGAATCTCGAGATTCAGCCGAGGAGGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-930s21c1
Sequence:GTACCGGGGTGGTTATCAACCCGATTACCTCGAGGTAATCGGGTTGATAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-625s21c1
Sequence:GTACCGGCCACTGACCCAGAGAACATTACTCGAGTAATGTTCTCTGGGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009305
SYP MISSION shRNA Lentiviral Transduction Particles
synaptophysin
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-175s1c1
Sequence:CCGGCTCAACATCGAAGTCGAATTTCTCGAGAAATTCGACTTCGATGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-797s1c1
Sequence:CCGGAGGGTGGTTATCAACCCGATTCTCGAGAATCGGGTTGATAACCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-173s1c1
Sequence:CCGGCCCTCAACATCGAAGTCGAATCTCGAGATTCGACTTCGATGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009305.1-1831s1c1
Sequence:CCGGCGGTTTCAGTTGAGTGGAGTTCTCGAGAACTCCACTCAACTGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-537s1c1
Sequence:CCGGCCAGACAGGAAACACATGCAACTCGAGTTGCATGTGTTTCCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-1039s21c1
Sequence:GTACCGGCCTTCTCCAATCAGATGTAATCTCGAGATTACATCTGATTGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-307s21c1
Sequence:GTACCGGTCAACATCGAAGTCGAATTTGCTCGAGCAAATTCGACTTCGATGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-359s21c1
Sequence:GTACCGGTGATGCACCCTCCTGCGTTAACTCGAGTTAACGCAGGAGGGTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-412s21c1
Sequence:GTACCGGACTACTCCTCCTCGGCTGAATCTCGAGATTCAGCCGAGGAGGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-930s21c1
Sequence:GTACCGGGGTGGTTATCAACCCGATTACCTCGAGGTAATCGGGTTGATAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-625s21c1
Sequence:GTACCGGCCACTGACCCAGAGAACATTACTCGAGTAATGTTCTCTGGGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks