EMAIL THIS PAGE TO A FRIEND

SYPL1

synaptophysin-like 1

Synonyms: H-SP1 SYPL
UniProtKB ID: Q16563, Q96AR8
Gene ID:
Rat(366595) synaptophysin-like 1
cow(615728) synaptophysin-like 1
sheep(101105241) synaptophysin-like 1
naked mole-rat(101709328) synaptophysin-like 1
domestic guinea pig(100720615) synaptophysin-like 1
chicken(417708) synaptophysin-like 1
dog(475889) synaptophysin-like 1
domestic cat(101081616) synaptophysin-like 1
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006754 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144291 MISSION® esiRNA esiRNA human SYPL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006754 Rosetta Predictions human pricing
NM_182715 Rosetta Predictions human pricing
NM_001014263 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141974 predicted 501
2 SASI_Hs01_00141975 predicted 501
3 SASI_Hs01_00141976 predicted 514
4 SASI_Hs02_00342230 predicted 880
5 SASI_Hs01_00141977 predicted 529
6 SASI_Hs01_00141978 predicted 899
7 SASI_Hs02_00342231 predicted 919
8 SASI_Hs01_00141979 predicted 752
9 SASI_Hs01_00141981 predicted 645
10 SASI_Hs01_00141983 predicted 483
11 SASI_Hs01_00141980 predicted 713
12 SASI_Hs01_00141982 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025817 predicted 467
2 SASI_Hs01_00025818 predicted 468
3 SASI_Hs01_00025819 predicted 478
4 SASI_Hs02_00370880 predicted 846
5 SASI_Hs01_00025820 predicted 498
6 SASI_Hs01_00025821 predicted 871
7 SASI_Hs02_00370881 predicted 887
8 SASI_Hs01_00025822 predicted 718
9 SASI_Hs01_00025824 predicted 611
10 SASI_Hs01_00025826 predicted 446
11 SASI_Hs01_00025823 predicted 677
12 SASI_Hs01_00025825 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014263 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046944 predicted 338
2 SASI_Rn01_00046945 predicted 569
3 SASI_Rn02_00201832 predicted 509
4 SASI_Rn01_00046946 predicted 660
5 SASI_Rn01_00046947 predicted 594
6 SASI_Rn01_00046948 predicted 689
7 SASI_Rn01_00046949 predicted 462
8 SASI_Rn01_00046950 predicted 304
9 SASI_Rn01_00046952 predicted 513
10 SASI_Rn01_00046953 predicted 650
11 SASI_Rn01_00046951 predicted 382
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006754
VALIDATED
SYPL1 MISSION shRNA Bacterial Glycerol Stock
synaptophysin-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006754.2-530s1c1
Sequence:CCGGCCTATGATAGACTTTGTTGTTCTCGAGAACAACAAAGTCTATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006754.2-196s1c1
Sequence:CCGGCCTCGAGTGGATTGCTTCTATCTCGAGATAGAAGCAATCCACTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006754.2-653s1c1
Sequence:CCGGCCGCCTTGTAAGAAGAAAGCACTCGAGTGCTTTCTTCTTACAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006754.2-792s1c1
Sequence:CCGGGCCTACACAGTCCATCAAATACTCGAGTATTTGATGGACTGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006754.2-359s1c1
Sequence:CCGGCCAGGTGTAAACATATGTGATCTCGAGATCACATATGTTTACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006754.2-359s21c1
Sequence:CCGGCCAGGTGTAAACATATGTGATCTCGAGATCACATATGTTTACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006754.2-196s21c1
Sequence:CCGGCCTCGAGTGGATTGCTTCTATCTCGAGATAGAAGCAATCCACTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006754.2-653s21c1
Sequence:CCGGCCGCCTTGTAAGAAGAAAGCACTCGAGTGCTTTCTTCTTACAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006754.2-530s21c1
Sequence:CCGGCCTATGATAGACTTTGTTGTTCTCGAGAACAACAAAGTCTATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006754
VALIDATED
SYPL1 MISSION shRNA shRNA Plasmid DNA
synaptophysin-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006754.2-530s1c1
Sequence:CCGGCCTATGATAGACTTTGTTGTTCTCGAGAACAACAAAGTCTATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006754.2-196s1c1
Sequence:CCGGCCTCGAGTGGATTGCTTCTATCTCGAGATAGAAGCAATCCACTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006754.2-653s1c1
Sequence:CCGGCCGCCTTGTAAGAAGAAAGCACTCGAGTGCTTTCTTCTTACAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006754.2-792s1c1
Sequence:CCGGGCCTACACAGTCCATCAAATACTCGAGTATTTGATGGACTGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006754.2-359s1c1
Sequence:CCGGCCAGGTGTAAACATATGTGATCTCGAGATCACATATGTTTACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006754.2-359s21c1
Sequence:CCGGCCAGGTGTAAACATATGTGATCTCGAGATCACATATGTTTACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006754.2-196s21c1
Sequence:CCGGCCTCGAGTGGATTGCTTCTATCTCGAGATAGAAGCAATCCACTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006754.2-653s21c1
Sequence:CCGGCCGCCTTGTAAGAAGAAAGCACTCGAGTGCTTTCTTCTTACAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006754.2-530s21c1
Sequence:CCGGCCTATGATAGACTTTGTTGTTCTCGAGAACAACAAAGTCTATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006754
VALIDATED
SYPL1 MISSION shRNA Lentiviral Transduction Particles
synaptophysin-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006754.2-530s1c1
Sequence:CCGGCCTATGATAGACTTTGTTGTTCTCGAGAACAACAAAGTCTATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006754.2-196s1c1
Sequence:CCGGCCTCGAGTGGATTGCTTCTATCTCGAGATAGAAGCAATCCACTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006754.2-653s1c1
Sequence:CCGGCCGCCTTGTAAGAAGAAAGCACTCGAGTGCTTTCTTCTTACAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006754.2-792s1c1
Sequence:CCGGGCCTACACAGTCCATCAAATACTCGAGTATTTGATGGACTGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006754.2-359s1c1
Sequence:CCGGCCAGGTGTAAACATATGTGATCTCGAGATCACATATGTTTACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006754.2-359s21c1
Sequence:CCGGCCAGGTGTAAACATATGTGATCTCGAGATCACATATGTTTACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006754.2-196s21c1
Sequence:CCGGCCTCGAGTGGATTGCTTCTATCTCGAGATAGAAGCAATCCACTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006754.2-653s21c1
Sequence:CCGGCCGCCTTGTAAGAAGAAAGCACTCGAGTGCTTTCTTCTTACAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006754.2-530s21c1
Sequence:CCGGCCTATGATAGACTTTGTTGTTCTCGAGAACAACAAAGTCTATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks