EMAIL THIS PAGE TO A FRIEND

SYPL2

synaptophysin-like 2

Synonyms: MG29
UniProtKB ID: Q5VXT5, A8K0E8, A8KAL7, I0IT67, Q6ZMX1
Gene ID:
Mouse(17306) synaptophysin-like 2
Rat(362018) synaptophysin-like 2
chicken(100858920) synaptophysin-like 2
domestic cat(101090453) synaptophysin-like 2
dog(611827) synaptophysin-like 2
domestic guinea pig(100730590) synaptophysin-like 2
naked mole-rat(101699475) synaptophysin-like 2
Domestic Rabbit(100008596) synaptophysin-like 2
cow(514665) synaptophysin-like 2
sheep(101103207) synaptophysin-like 2
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001006603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006603 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008596 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008596 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008596 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006603 Rosetta Predictions human pricing
NM_001040709 Rosetta Predictions human pricing
NM_001108563 Rosetta Predictions rat pricing
NM_008596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195866 predicted 418
2 SASI_Hs01_00195867 predicted 761
3 SASI_Hs01_00195868 predicted 623
4 SASI_Hs01_00195869 predicted 540
5 SASI_Hs01_00195870 predicted 350
6 SASI_Hs01_00195871 predicted 342
7 SASI_Hs01_00195872 predicted 541
8 SASI_Hs01_00195873 predicted 554
9 SASI_Hs01_00195874 predicted 916
10 SASI_Hs01_00195875 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309109 predicted 586
2 SASI_Hs02_00309110 predicted 1579
3 SASI_Hs02_00309111 predicted 1512
4 SASI_Hs02_00309112 predicted 567
5 SASI_Hs02_00309113 predicted 1548
6 SASI_Hs02_00309114 predicted 545
7 SASI_Hs02_00309115 predicted 546
8 SASI_Hs02_00309116 predicted 1523
9 SASI_Hs02_00309117 predicted 1580
10 SASI_Hs02_00309118 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239869 predicted 623
2 SASI_Rn02_00239870 predicted 820
3 SASI_Rn02_00239871 predicted 1408
4 SASI_Rn02_00239872 predicted 1288
5 SASI_Rn02_00239873 predicted 1308
6 SASI_Rn02_00239874 predicted 1070
7 SASI_Rn02_00239875 predicted 1084
8 SASI_Rn02_00239876 predicted 1012
9 SASI_Rn02_00239877 predicted 416
10 SASI_Rn02_00239878 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047834 predicted 1342
2 SASI_Mm01_00047835 predicted 1412
3 SASI_Mm01_00047836 predicted 431
4 SASI_Mm01_00047837 predicted 566
5 SASI_Mm01_00047838 predicted 643
6 SASI_Mm01_00047839 predicted 1326
7 SASI_Mm01_00047840 predicted 387
8 SASI_Mm01_00047841 predicted 1429
9 SASI_Mm01_00047842 predicted 449
10 SASI_Mm01_00047843 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006603
SYPL2 MISSION shRNA Bacterial Glycerol Stock
synaptophysin-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006603.1-627s1c1
Sequence:CCGGCCTCTCTAAACACCATCCATACTCGAGTATGGATGGTGTTTAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006603.1-756s1c1
Sequence:CCGGCCCTCAGTGAAAGAATTAGTTCTCGAGAACTAATTCTTTCACTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006603.1-1196s1c1
Sequence:CCGGCCTCGTTCTCTTTCTTCTCAACTCGAGTTGAGAAGAAAGAGAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006603.1-367s1c1
Sequence:CCGGGTGTATATCCTCTTCCTGATACTCGAGTATCAGGAAGAGGATATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006603.1-413s1c1
Sequence:CCGGCAAGGCTGAGAATCAGTGTTACTCGAGTAACACTGATTCTCAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006603.1-378s1c1
Sequence:CCGGCTTCCTGATACCTCCTTCAGTCTCGAGACTGAAGGAGGTATCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006603.1-263s1c1
Sequence:CCGGCCTGTGTCCTTATTTCTCCCACTCGAGTGGGAGAAATAAGGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006603
SYPL2 MISSION shRNA shRNA Plasmid DNA
synaptophysin-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006603.1-627s1c1
Sequence:CCGGCCTCTCTAAACACCATCCATACTCGAGTATGGATGGTGTTTAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006603.1-756s1c1
Sequence:CCGGCCCTCAGTGAAAGAATTAGTTCTCGAGAACTAATTCTTTCACTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006603.1-1196s1c1
Sequence:CCGGCCTCGTTCTCTTTCTTCTCAACTCGAGTTGAGAAGAAAGAGAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006603.1-367s1c1
Sequence:CCGGGTGTATATCCTCTTCCTGATACTCGAGTATCAGGAAGAGGATATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006603.1-413s1c1
Sequence:CCGGCAAGGCTGAGAATCAGTGTTACTCGAGTAACACTGATTCTCAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006603.1-378s1c1
Sequence:CCGGCTTCCTGATACCTCCTTCAGTCTCGAGACTGAAGGAGGTATCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006603.1-263s1c1
Sequence:CCGGCCTGTGTCCTTATTTCTCCCACTCGAGTGGGAGAAATAAGGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006603
SYPL2 MISSION shRNA Lentiviral Transduction Particles
synaptophysin-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006603.1-627s1c1
Sequence:CCGGCCTCTCTAAACACCATCCATACTCGAGTATGGATGGTGTTTAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006603.1-756s1c1
Sequence:CCGGCCCTCAGTGAAAGAATTAGTTCTCGAGAACTAATTCTTTCACTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006603.1-1196s1c1
Sequence:CCGGCCTCGTTCTCTTTCTTCTCAACTCGAGTTGAGAAGAAAGAGAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006603.1-367s1c1
Sequence:CCGGGTGTATATCCTCTTCCTGATACTCGAGTATCAGGAAGAGGATATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006603.1-413s1c1
Sequence:CCGGCAAGGCTGAGAATCAGTGTTACTCGAGTAACACTGATTCTCAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006603.1-378s1c1
Sequence:CCGGCTTCCTGATACCTCCTTCAGTCTCGAGACTGAAGGAGGTATCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006603.1-263s1c1
Sequence:CCGGCCTGTGTCCTTATTTCTCCCACTCGAGTGGGAGAAATAAGGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008596
SYPL2 MISSION shRNA Bacterial Glycerol Stock
synaptophysin-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008596.1-1332s1c1
Sequence:CCGGCCTCAATAACTGGCATCTAATCTCGAGATTAGATGCCAGTTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008596.1-374s1c1
Sequence:CCGGTCTCTGCAACAACGAAGCCAACTCGAGTTGGCTTCGTTGTTGCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008596.1-599s1c1
Sequence:CCGGCCACAAACTCTACACAGAGAACTCGAGTTCTCTGTGTAGAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008596.1-863s1c1
Sequence:CCGGTGGAAACTGTTGGTTTGTGTTCTCGAGAACACAAACCAACAGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008596.1-525s1c1
Sequence:CCGGGCCGAGTTCTTTGTGACCCTTCTCGAGAAGGGTCACAAAGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008596
SYPL2 MISSION shRNA shRNA Plasmid DNA
synaptophysin-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008596.1-1332s1c1
Sequence:CCGGCCTCAATAACTGGCATCTAATCTCGAGATTAGATGCCAGTTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008596.1-374s1c1
Sequence:CCGGTCTCTGCAACAACGAAGCCAACTCGAGTTGGCTTCGTTGTTGCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008596.1-599s1c1
Sequence:CCGGCCACAAACTCTACACAGAGAACTCGAGTTCTCTGTGTAGAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008596.1-863s1c1
Sequence:CCGGTGGAAACTGTTGGTTTGTGTTCTCGAGAACACAAACCAACAGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008596.1-525s1c1
Sequence:CCGGGCCGAGTTCTTTGTGACCCTTCTCGAGAAGGGTCACAAAGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008596
SYPL2 MISSION shRNA Lentiviral Transduction Particles
synaptophysin-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008596.1-1332s1c1
Sequence:CCGGCCTCAATAACTGGCATCTAATCTCGAGATTAGATGCCAGTTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008596.1-374s1c1
Sequence:CCGGTCTCTGCAACAACGAAGCCAACTCGAGTTGGCTTCGTTGTTGCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008596.1-599s1c1
Sequence:CCGGCCACAAACTCTACACAGAGAACTCGAGTTCTCTGTGTAGAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008596.1-863s1c1
Sequence:CCGGTGGAAACTGTTGGTTTGTGTTCTCGAGAACACAAACCAACAGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008596.1-525s1c1
Sequence:CCGGGCCGAGTTCTTTGTGACCCTTCTCGAGAAGGGTCACAAAGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks