EMAIL THIS PAGE TO A FRIEND

SYS1

SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)

Synonyms: C20orf169 dJ453C12.4 dJ453C12.4.1
Gene ID:
Human(90196) Summary: SYS1 forms a complex with ADP-ribosylation factor-related protein ARFRP1 (MIM 604699) and targets ARFRP1 to the Golgi apparatus (Behnia et al., 2004 [PubMed 15077113]
Mouse(66460) SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
Rat(685079) SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
chicken(419183) SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
domestic cat(101090179) SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
dog(485894) SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
cow(614236) SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
sheep(101111477) SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
naked mole-rat(101700112) SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
189 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025575 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025575 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025575 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033542 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033542 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033542 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033542 Rosetta Predictions human pricing
XM_001062200 Rosetta Predictions rat pricing
NM_025575 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134699 predicted 724
2 SASI_Hs01_00134702 predicted 1132
3 SASI_Hs01_00134703 predicted 1075
4 SASI_Hs01_00134704 predicted 1168
5 SASI_Hs01_00134706 predicted 853
6 SASI_Hs01_00134707 predicted 916
7 SASI_Hs02_00361414 predicted 994
8 SASI_Hs01_00134708 predicted 1061
9 SASI_Hs02_00361415 predicted 575
10 SASI_Hs02_00361416 predicted 1115
11 SASI_Hs01_00134700 predicted 831
12 SASI_Hs01_00134701 predicted 906
13 SASI_Hs01_00134705 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302642 predicted 724
2 SASI_Rn02_00302643 predicted 517
3 SASI_Rn02_00302644 predicted 310
4 SASI_Rn02_00302645 predicted 619
5 SASI_Rn02_00302646 predicted 631
6 SASI_Rn02_00302647 predicted 300
7 SASI_Rn02_00302648 predicted 541
8 SASI_Rn02_00302649 predicted 284
9 SASI_Rn02_00302650 predicted 454
10 SASI_Rn02_00302651 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040502 predicted 482
2 SASI_Mm01_00040503 predicted 251
3 SASI_Mm01_00040504 predicted 279
4 SASI_Mm01_00040505 predicted 270
5 SASI_Mm01_00040506 predicted 510
6 SASI_Mm01_00040507 predicted 294
7 SASI_Mm02_00328553 predicted 231
8 SASI_Mm01_00040508 predicted 594
9 SASI_Mm01_00040509 predicted 483
10 SASI_Mm01_00040510 predicted 427
11 SASI_Mm01_00040511 predicted 668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025575
VALIDATED
SYS1 MISSION shRNA Bacterial Glycerol Stock
SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025575.1-765s1c1
Sequence:CCGGCCTGGAAATGTGAAGTCTGTTCTCGAGAACAGACTTCACATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025575.1-481s1c1
Sequence:CCGGACTGTCACTGTGCATTTCTTTCTCGAGAAAGAAATGCACAGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025575.1-342s1c1
Sequence:CCGGCCAGATGTTCGACGCGGAGATCTCGAGATCTCCGCGTCGAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025575.1-261s1c1
Sequence:CCGGCTCATGCAGACCGTCTACTATCTCGAGATAGTAGACGGTCTGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025575.1-236s1c1
Sequence:CCGGGTTGCTAATCCTGTCGCAGATCTCGAGATCTGCGACAGGATTAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025575.3-508s21c1
Sequence:CCGGACTGTCACTGTGCATTTCTTTCTCGAGAAAGAAATGCACAGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025575.3-369s21c1
Sequence:CCGGCCAGATGTTCGACGCGGAGATCTCGAGATCTCCGCGTCGAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025575.3-286s21c1
Sequence:CCGGCTCATGCAGACCGTCTACTATCTCGAGATAGTAGACGGTCTGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025575.3-261s21c1
Sequence:CCGGGTTGCTAATCCTGTCGCAGATCTCGAGATCTGCGACAGGATTAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025575.3-792s21c1
Sequence:CCGGCCTGGAAATGTGAAGTCTGTTCTCGAGAACAGACTTCACATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025575
VALIDATED
SYS1 MISSION shRNA shRNA Plasmid DNA
SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025575.1-765s1c1
Sequence:CCGGCCTGGAAATGTGAAGTCTGTTCTCGAGAACAGACTTCACATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025575.1-481s1c1
Sequence:CCGGACTGTCACTGTGCATTTCTTTCTCGAGAAAGAAATGCACAGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025575.1-342s1c1
Sequence:CCGGCCAGATGTTCGACGCGGAGATCTCGAGATCTCCGCGTCGAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025575.1-261s1c1
Sequence:CCGGCTCATGCAGACCGTCTACTATCTCGAGATAGTAGACGGTCTGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025575.1-236s1c1
Sequence:CCGGGTTGCTAATCCTGTCGCAGATCTCGAGATCTGCGACAGGATTAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025575.3-508s21c1
Sequence:CCGGACTGTCACTGTGCATTTCTTTCTCGAGAAAGAAATGCACAGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025575.3-369s21c1
Sequence:CCGGCCAGATGTTCGACGCGGAGATCTCGAGATCTCCGCGTCGAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025575.3-286s21c1
Sequence:CCGGCTCATGCAGACCGTCTACTATCTCGAGATAGTAGACGGTCTGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025575.3-261s21c1
Sequence:CCGGGTTGCTAATCCTGTCGCAGATCTCGAGATCTGCGACAGGATTAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025575.3-792s21c1
Sequence:CCGGCCTGGAAATGTGAAGTCTGTTCTCGAGAACAGACTTCACATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025575
VALIDATED
SYS1 MISSION shRNA Lentiviral Transduction Particles
SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025575.1-765s1c1
Sequence:CCGGCCTGGAAATGTGAAGTCTGTTCTCGAGAACAGACTTCACATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025575.1-481s1c1
Sequence:CCGGACTGTCACTGTGCATTTCTTTCTCGAGAAAGAAATGCACAGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025575.1-342s1c1
Sequence:CCGGCCAGATGTTCGACGCGGAGATCTCGAGATCTCCGCGTCGAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025575.1-261s1c1
Sequence:CCGGCTCATGCAGACCGTCTACTATCTCGAGATAGTAGACGGTCTGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025575.1-236s1c1
Sequence:CCGGGTTGCTAATCCTGTCGCAGATCTCGAGATCTGCGACAGGATTAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025575.3-508s21c1
Sequence:CCGGACTGTCACTGTGCATTTCTTTCTCGAGAAAGAAATGCACAGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025575.3-369s21c1
Sequence:CCGGCCAGATGTTCGACGCGGAGATCTCGAGATCTCCGCGTCGAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025575.3-286s21c1
Sequence:CCGGCTCATGCAGACCGTCTACTATCTCGAGATAGTAGACGGTCTGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025575.3-261s21c1
Sequence:CCGGGTTGCTAATCCTGTCGCAGATCTCGAGATCTGCGACAGGATTAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025575.3-792s21c1
Sequence:CCGGCCTGGAAATGTGAAGTCTGTTCTCGAGAACAGACTTCACATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033542
VALIDATED
SYS1 MISSION shRNA Bacterial Glycerol Stock
SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_033542.2-963s21c1
Sequence:CCGGGGACCTCTTTGAGGGTAATAACTCGAGTTATTACCCTCAAAGAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_033542.2-505s21c1
Sequence:CCGGTACTTCATCCGGCGAGGAAAGCTCGAGCTTTCCTCGCCGGATGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033542.2-713s21c1
Sequence:CCGGCTAAATCCAATGTCTAGAATCCTCGAGGATTCTAGACATTGGATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_033542.2-317s21c1
Sequence:CCGGTCCTCATGCAGACCGTGTATTCTCGAGAATACACGGTCTGCATGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_033542.2-537s21c1
Sequence:CCGGTTTCACTGTCACTGTCCATTTCTCGAGAAATGGACAGTGACAGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033542
VALIDATED
SYS1 MISSION shRNA shRNA Plasmid DNA
SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_033542.2-963s21c1
Sequence:CCGGGGACCTCTTTGAGGGTAATAACTCGAGTTATTACCCTCAAAGAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_033542.2-505s21c1
Sequence:CCGGTACTTCATCCGGCGAGGAAAGCTCGAGCTTTCCTCGCCGGATGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033542.2-713s21c1
Sequence:CCGGCTAAATCCAATGTCTAGAATCCTCGAGGATTCTAGACATTGGATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_033542.2-317s21c1
Sequence:CCGGTCCTCATGCAGACCGTGTATTCTCGAGAATACACGGTCTGCATGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_033542.2-537s21c1
Sequence:CCGGTTTCACTGTCACTGTCCATTTCTCGAGAAATGGACAGTGACAGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033542
VALIDATED
SYS1 MISSION shRNA Lentiviral Transduction Particles
SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_033542.2-963s21c1
Sequence:CCGGGGACCTCTTTGAGGGTAATAACTCGAGTTATTACCCTCAAAGAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_033542.2-505s21c1
Sequence:CCGGTACTTCATCCGGCGAGGAAAGCTCGAGCTTTCCTCGCCGGATGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033542.2-713s21c1
Sequence:CCGGCTAAATCCAATGTCTAGAATCCTCGAGGATTCTAGACATTGGATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_033542.2-317s21c1
Sequence:CCGGTCCTCATGCAGACCGTGTATTCTCGAGAATACACGGTCTGCATGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_033542.2-537s21c1
Sequence:CCGGTTTCACTGTCACTGTCCATTTCTCGAGAAATGGACAGTGACAGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks