EMAIL THIS PAGE TO A FRIEND

SYT10

synaptotagmin X

UniProtKB ID: Q6XYQ8, Q495U2
Gene ID:
Mouse(54526) synaptotagmin X
Rat(60567) synaptotagmin X
Zebrafish(564226) synaptotagmin X
dog(486612) synaptotagmin X
domestic cat(101091953) synaptotagmin X
Horse(100070119) synaptotagmin X
chicken(418129) synaptotagmin X
cow(537613) synaptotagmin X
sheep(101104476) synaptotagmin X
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA055426 Anti-SYT10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198992 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198992 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198992 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042351 MISSION® esiRNA esiRNA human SYT10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198992 Rosetta Predictions human pricing
NM_031666 Rosetta Predictions rat pricing
NM_018803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090317 predicted 838
2 SASI_Hs01_00090318 predicted 1095
3 SASI_Hs02_00372505 predicted 593
4 SASI_Hs01_00090319 predicted 1645
5 SASI_Hs01_00090320 predicted 1053
6 SASI_Hs01_00090321 predicted 1375
7 SASI_Hs01_00090322 predicted 1562
8 SASI_Hs01_00090324 predicted 1466
9 SASI_Hs01_00090325 predicted 1451
10 SASI_Hs01_00090326 predicted 1576
11 SASI_Hs01_00090323 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057484 predicted 930
2 SASI_Rn01_00057485 predicted 429
3 SASI_Rn01_00057486 predicted 756
4 SASI_Rn01_00057487 predicted 938
5 SASI_Rn01_00057488 predicted 370
6 SASI_Rn01_00057489 predicted 438
7 SASI_Rn02_00265007 predicted 995
8 SASI_Rn02_00265008 predicted 986
9 SASI_Rn01_00057490 predicted 931
10 SASI_Rn01_00057491 predicted 647
11 SASI_Rn01_00057492 predicted 880
12 SASI_Rn01_00057493 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174108 predicted 429
2 SASI_Mm01_00174109 predicted 1299
3 SASI_Mm01_00174110 predicted 432
4 SASI_Mm01_00174111 predicted 759
5 SASI_Mm01_00174112 predicted 292
6 SASI_Mm01_00174113 predicted 292
7 SASI_Mm01_00174114 predicted 569
8 SASI_Mm01_00174115 predicted 995
9 SASI_Mm01_00174116 predicted 1130
10 SASI_Mm01_00174117 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018803
SYT10 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin X
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018803.1-1576s1c1
Sequence:CCGGCCTCCAAATAAGACCATATCACTCGAGTGATATGGTCTTATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018803.1-1293s1c1
Sequence:CCGGCGAAGCCATTATCTTCGATATCTCGAGATATCGAAGATAATGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018803.1-1513s1c1
Sequence:CCGGGCCACCAGCTTTGATAGTCAACTCGAGTTGACTATCAAAGCTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018803.1-584s1c1
Sequence:CCGGCCATCTTACAAAGAGGAGAAACTCGAGTTTCTCCTCTTTGTAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018803.1-880s1c1
Sequence:CCGGCCTCTGTTTGATGAGCTATTTCTCGAGAAATAGCTCATCAAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-375s21c1
Sequence:GTACCGGAGCCATTGAGCCTGCAATAAACTCGAGTTTATTGCAGGCTCAATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-929s21c1
Sequence:GTACCGGGCAACCGCAAACTACACTTTACTCGAGTAAAGTGTAGTTTGCGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-803s21c1
Sequence:GTACCGGATCCTTATGTGAAGATCTATCCTCGAGGATAGATCTTCACATAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-95s21c1
Sequence:GTACCGGACAAGTGTTCGGGCATCTTTCCTCGAGGAAAGATGCCCGAACACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-548s21c1
Sequence:GTACCGGATGTCTCCAGCGTCGACTTTACTCGAGTAAAGTCGACGCTGGAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018803
SYT10 MISSION shRNA shRNA Plasmid DNA
synaptotagmin X
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018803.1-1576s1c1
Sequence:CCGGCCTCCAAATAAGACCATATCACTCGAGTGATATGGTCTTATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018803.1-1293s1c1
Sequence:CCGGCGAAGCCATTATCTTCGATATCTCGAGATATCGAAGATAATGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018803.1-1513s1c1
Sequence:CCGGGCCACCAGCTTTGATAGTCAACTCGAGTTGACTATCAAAGCTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018803.1-584s1c1
Sequence:CCGGCCATCTTACAAAGAGGAGAAACTCGAGTTTCTCCTCTTTGTAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018803.1-880s1c1
Sequence:CCGGCCTCTGTTTGATGAGCTATTTCTCGAGAAATAGCTCATCAAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-375s21c1
Sequence:GTACCGGAGCCATTGAGCCTGCAATAAACTCGAGTTTATTGCAGGCTCAATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-929s21c1
Sequence:GTACCGGGCAACCGCAAACTACACTTTACTCGAGTAAAGTGTAGTTTGCGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-803s21c1
Sequence:GTACCGGATCCTTATGTGAAGATCTATCCTCGAGGATAGATCTTCACATAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-95s21c1
Sequence:GTACCGGACAAGTGTTCGGGCATCTTTCCTCGAGGAAAGATGCCCGAACACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-548s21c1
Sequence:GTACCGGATGTCTCCAGCGTCGACTTTACTCGAGTAAAGTCGACGCTGGAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018803
SYT10 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin X
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018803.1-1576s1c1
Sequence:CCGGCCTCCAAATAAGACCATATCACTCGAGTGATATGGTCTTATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018803.1-1293s1c1
Sequence:CCGGCGAAGCCATTATCTTCGATATCTCGAGATATCGAAGATAATGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018803.1-1513s1c1
Sequence:CCGGGCCACCAGCTTTGATAGTCAACTCGAGTTGACTATCAAAGCTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018803.1-584s1c1
Sequence:CCGGCCATCTTACAAAGAGGAGAAACTCGAGTTTCTCCTCTTTGTAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018803.1-880s1c1
Sequence:CCGGCCTCTGTTTGATGAGCTATTTCTCGAGAAATAGCTCATCAAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-375s21c1
Sequence:GTACCGGAGCCATTGAGCCTGCAATAAACTCGAGTTTATTGCAGGCTCAATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-929s21c1
Sequence:GTACCGGGCAACCGCAAACTACACTTTACTCGAGTAAAGTGTAGTTTGCGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-803s21c1
Sequence:GTACCGGATCCTTATGTGAAGATCTATCCTCGAGGATAGATCTTCACATAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-95s21c1
Sequence:GTACCGGACAAGTGTTCGGGCATCTTTCCTCGAGGAAAGATGCCCGAACACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018803.1-548s21c1
Sequence:GTACCGGATGTCTCCAGCGTCGACTTTACTCGAGTAAAGTCGACGCTGGAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198992
SYT10 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin X
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-1433s1c1
Sequence:CCGGCGTATGACATTGACAGTCATTCTCGAGAATGACTGTCAATGTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-1473s1c1
Sequence:CCGGCGATGGATATTACTGGCTCATCTCGAGATGAGCCAGTAATATCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-1011s1c1
Sequence:CCGGCCCTCCAGTATGATTATGAAACTCGAGTTTCATAATCATACTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-929s1c1
Sequence:CCGGCCAGAACTCTACAAACAGAAACTCGAGTTTCTGTTTGTAGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-497s1c1
Sequence:CCGGGCCTTGTTGGTTGTCTCACTTCTCGAGAAGTGAGACAACCAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1582s21c1
Sequence:GTACCGGGTGTACAATGAGGCCATTATTCTCGAGAATAATGGCCTCATTGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198992.2-2335s21c1
Sequence:GTACCGGTAAATCCTTGCGCAATCAAATCTCGAGATTTGATTGCGCAAGGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-723s21c1
Sequence:GTACCGGAGAAGTCCAAACTGCTTTAAACTCGAGTTTAAAGCAGTTTGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1851s21c1
Sequence:GTACCGGACCACCTTCCACACCATAATGCTCGAGCATTATGGTGTGGAAGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1154s21c1
Sequence:GTACCGGGCGTGCACAGAAAGACTTTAACTCGAGTTAAAGTCTTTCTGTGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1290s21c1
Sequence:GTACCGGGGAAGTGATTCTTGATAATTTCTCGAGAAATTATCAAGAATCACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1463s21c1
Sequence:GTACCGGATCTGAAGGCGATGGATATTACTCGAGTAATATCCATCGCCTTCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198992.2-2060s21c1
Sequence:GTACCGGATATAGTCCTTAGTTGCATAACTCGAGTTATGCAACTAAGGACTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-762s21c1
Sequence:GTACCGGTGCACGTGTGCAAAGACAAATCTCGAGATTTGTCTTTGCACACGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198992
SYT10 MISSION shRNA shRNA Plasmid DNA
synaptotagmin X
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-1433s1c1
Sequence:CCGGCGTATGACATTGACAGTCATTCTCGAGAATGACTGTCAATGTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-1473s1c1
Sequence:CCGGCGATGGATATTACTGGCTCATCTCGAGATGAGCCAGTAATATCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-1011s1c1
Sequence:CCGGCCCTCCAGTATGATTATGAAACTCGAGTTTCATAATCATACTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-929s1c1
Sequence:CCGGCCAGAACTCTACAAACAGAAACTCGAGTTTCTGTTTGTAGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-497s1c1
Sequence:CCGGGCCTTGTTGGTTGTCTCACTTCTCGAGAAGTGAGACAACCAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1582s21c1
Sequence:GTACCGGGTGTACAATGAGGCCATTATTCTCGAGAATAATGGCCTCATTGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198992.2-2335s21c1
Sequence:GTACCGGTAAATCCTTGCGCAATCAAATCTCGAGATTTGATTGCGCAAGGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-723s21c1
Sequence:GTACCGGAGAAGTCCAAACTGCTTTAAACTCGAGTTTAAAGCAGTTTGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1851s21c1
Sequence:GTACCGGACCACCTTCCACACCATAATGCTCGAGCATTATGGTGTGGAAGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1154s21c1
Sequence:GTACCGGGCGTGCACAGAAAGACTTTAACTCGAGTTAAAGTCTTTCTGTGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1290s21c1
Sequence:GTACCGGGGAAGTGATTCTTGATAATTTCTCGAGAAATTATCAAGAATCACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1463s21c1
Sequence:GTACCGGATCTGAAGGCGATGGATATTACTCGAGTAATATCCATCGCCTTCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198992.2-2060s21c1
Sequence:GTACCGGATATAGTCCTTAGTTGCATAACTCGAGTTATGCAACTAAGGACTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-762s21c1
Sequence:GTACCGGTGCACGTGTGCAAAGACAAATCTCGAGATTTGTCTTTGCACACGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198992
SYT10 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin X
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-1433s1c1
Sequence:CCGGCGTATGACATTGACAGTCATTCTCGAGAATGACTGTCAATGTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-1473s1c1
Sequence:CCGGCGATGGATATTACTGGCTCATCTCGAGATGAGCCAGTAATATCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-1011s1c1
Sequence:CCGGCCCTCCAGTATGATTATGAAACTCGAGTTTCATAATCATACTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-929s1c1
Sequence:CCGGCCAGAACTCTACAAACAGAAACTCGAGTTTCTGTTTGTAGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198992.1-497s1c1
Sequence:CCGGGCCTTGTTGGTTGTCTCACTTCTCGAGAAGTGAGACAACCAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1582s21c1
Sequence:GTACCGGGTGTACAATGAGGCCATTATTCTCGAGAATAATGGCCTCATTGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198992.2-2335s21c1
Sequence:GTACCGGTAAATCCTTGCGCAATCAAATCTCGAGATTTGATTGCGCAAGGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-723s21c1
Sequence:GTACCGGAGAAGTCCAAACTGCTTTAAACTCGAGTTTAAAGCAGTTTGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1851s21c1
Sequence:GTACCGGACCACCTTCCACACCATAATGCTCGAGCATTATGGTGTGGAAGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1154s21c1
Sequence:GTACCGGGCGTGCACAGAAAGACTTTAACTCGAGTTAAAGTCTTTCTGTGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1290s21c1
Sequence:GTACCGGGGAAGTGATTCTTGATAATTTCTCGAGAAATTATCAAGAATCACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-1463s21c1
Sequence:GTACCGGATCTGAAGGCGATGGATATTACTCGAGTAATATCCATCGCCTTCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198992.2-2060s21c1
Sequence:GTACCGGATATAGTCCTTAGTTGCATAACTCGAGTTATGCAACTAAGGACTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198992.2-762s21c1
Sequence:GTACCGGTGCACGTGTGCAAAGACAAATCTCGAGATTTGTCTTTGCACACGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks