EMAIL THIS PAGE TO A FRIEND

SYT11

synaptotagmin XI

Synonyms: SYT12 sytXI
UniProtKB ID: Q9BT88, Q14998, Q5W0D4, Q68CT5, Q8IXU3, Q96SU2
Gene ID:
Human(23208) Summary: This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that are known calcium sensors and mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. The encoded protein is also a substrate for ubiquitin-E3-ligase parkin. The gene has previously been referred to as synaptotagmin XII but has been renamed synaptotagmin XI to be consistent with mouse and rat official nomenclature. [provided by RefSeq, Apr 2010]
Mouse(229521) synaptotagmin XI
Rat(60568) synaptotagmin XI
cow(618177) synaptotagmin XI
sheep(101120970) synaptotagmin XI
naked mole-rat(101696751) synaptotagmin XI
chicken(429166) synaptotagmin XI
domestic cat(101085854) synaptotagmin XI
Horse(100057507) synaptotagmin XI
dog(490421) synaptotagmin XI
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152280 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152280 Rosetta Predictions human pricing
NM_031667 Rosetta Predictions rat pricing
NM_018804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078302 predicted 405
2 SASI_Hs01_00078303 predicted 643
3 SASI_Hs01_00078304 predicted 262
4 SASI_Hs01_00078305 predicted 1291
5 SASI_Hs01_00078306 predicted 519
6 SASI_Hs02_00365817 predicted 474
7 SASI_Hs01_00078307 predicted 392
8 SASI_Hs01_00078309 predicted 1163
9 SASI_Hs01_00078310 predicted 1224
10 SASI_Hs01_00078311 predicted 739
11 SASI_Hs01_00078308 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077735 predicted 876
2 SASI_Rn01_00077736 predicted 1326
3 SASI_Rn01_00077738 predicted 347
4 SASI_Rn01_00077739 predicted 1234
5 SASI_Rn01_00077740 predicted 1311
6 SASI_Rn02_00265009 predicted 1114
7 SASI_Rn01_00077741 predicted 436
8 SASI_Rn01_00077742 predicted 689
9 SASI_Rn01_00077743 predicted 805
10 SASI_Rn02_00265010 predicted 369
11 SASI_Rn01_00077737 predicted 447
12 SASI_Rn01_00077744 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324134 predicted 300
2 SASI_Mm02_00324135 predicted 1122
3 SASI_Mm02_00324136 predicted 1387
4 SASI_Mm02_00324137 predicted 1312
5 SASI_Mm02_00324138 predicted 1408
6 SASI_Mm02_00324139 predicted 420
7 SASI_Mm02_00324140 predicted 1182
8 SASI_Mm02_00324141 predicted 766
9 SASI_Mm02_00324142 predicted 1341
10 SASI_Mm02_00324143 predicted 742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152280
SYT11 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XI
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-1540s21c1
Sequence:GTACCGGACAGTCTGAGCGAGTACTAATCTCGAGATTAGTACTCGCTCAGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-409s21c1
Sequence:GTACCGGAGAACCCACCATACAAGTTTACTCGAGTAAACTTGTATGGTGGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-653s21c1
Sequence:GTACCGGAGAACTAAGGAGCCCTATTACCTCGAGGTAATAGGGCTCCTTAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-600s21c1
Sequence:GTACCGGCCTAGCTCTGGATCTTGTATACTCGAGTATACAAGATCCAGAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-1273s21c1
Sequence:GTACCGGACTACGGCAGAAAGCGCATTGCTCGAGCAATGCGCTTTCTGCCGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-1018s21c1
Sequence:GTACCGGTCTCTCGGGATGATGTCATTGCTCGAGCAATGACATCATCCCGAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-862s21c1
Sequence:GTACCGGTGACCATCCTTCCTGACAAACCTCGAGGTTTGTCAGGAAGGATGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-1389s21c1
Sequence:GTACCGGAGCATCGAGTTCCTCGTTATCCTCGAGGATAACGAGGAACTCGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152280.x-2390s1c1
Sequence:CCGGGCCTCTTATATCTCTGCTCTTCTCGAGAAGAGCAGAGATATAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152280.x-435s1c1
Sequence:CCGGGCATCAGCATATACCCAGAGACTCGAGTCTCTGGGTATATGCTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152280.x-608s1c1
Sequence:CCGGATAGACCAATTACCCATCAAACTCGAGTTTGATGGGTAATTGGTCTATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152280.x-478s1c1
Sequence:CCGGCATCAAAGTGCGGAGAGACAACTCGAGTTGTCTCTCCGCACTTTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152280.x-857s1c1
Sequence:CCGGATCCTTCCTGACAAACGGCATCTCGAGATGCCGTTTGTCAGGAAGGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152280
SYT11 MISSION shRNA shRNA Plasmid DNA
synaptotagmin XI
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-1540s21c1
Sequence:GTACCGGACAGTCTGAGCGAGTACTAATCTCGAGATTAGTACTCGCTCAGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-409s21c1
Sequence:GTACCGGAGAACCCACCATACAAGTTTACTCGAGTAAACTTGTATGGTGGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-653s21c1
Sequence:GTACCGGAGAACTAAGGAGCCCTATTACCTCGAGGTAATAGGGCTCCTTAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-600s21c1
Sequence:GTACCGGCCTAGCTCTGGATCTTGTATACTCGAGTATACAAGATCCAGAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-1273s21c1
Sequence:GTACCGGACTACGGCAGAAAGCGCATTGCTCGAGCAATGCGCTTTCTGCCGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-1018s21c1
Sequence:GTACCGGTCTCTCGGGATGATGTCATTGCTCGAGCAATGACATCATCCCGAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-862s21c1
Sequence:GTACCGGTGACCATCCTTCCTGACAAACCTCGAGGTTTGTCAGGAAGGATGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-1389s21c1
Sequence:GTACCGGAGCATCGAGTTCCTCGTTATCCTCGAGGATAACGAGGAACTCGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152280.x-2390s1c1
Sequence:CCGGGCCTCTTATATCTCTGCTCTTCTCGAGAAGAGCAGAGATATAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152280.x-435s1c1
Sequence:CCGGGCATCAGCATATACCCAGAGACTCGAGTCTCTGGGTATATGCTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152280.x-608s1c1
Sequence:CCGGATAGACCAATTACCCATCAAACTCGAGTTTGATGGGTAATTGGTCTATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152280.x-478s1c1
Sequence:CCGGCATCAAAGTGCGGAGAGACAACTCGAGTTGTCTCTCCGCACTTTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152280.x-857s1c1
Sequence:CCGGATCCTTCCTGACAAACGGCATCTCGAGATGCCGTTTGTCAGGAAGGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152280
SYT11 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XI
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-1540s21c1
Sequence:GTACCGGACAGTCTGAGCGAGTACTAATCTCGAGATTAGTACTCGCTCAGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-409s21c1
Sequence:GTACCGGAGAACCCACCATACAAGTTTACTCGAGTAAACTTGTATGGTGGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-653s21c1
Sequence:GTACCGGAGAACTAAGGAGCCCTATTACCTCGAGGTAATAGGGCTCCTTAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-600s21c1
Sequence:GTACCGGCCTAGCTCTGGATCTTGTATACTCGAGTATACAAGATCCAGAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-1273s21c1
Sequence:GTACCGGACTACGGCAGAAAGCGCATTGCTCGAGCAATGCGCTTTCTGCCGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-1018s21c1
Sequence:GTACCGGTCTCTCGGGATGATGTCATTGCTCGAGCAATGACATCATCCCGAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-862s21c1
Sequence:GTACCGGTGACCATCCTTCCTGACAAACCTCGAGGTTTGTCAGGAAGGATGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152280.3-1389s21c1
Sequence:GTACCGGAGCATCGAGTTCCTCGTTATCCTCGAGGATAACGAGGAACTCGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152280.x-2390s1c1
Sequence:CCGGGCCTCTTATATCTCTGCTCTTCTCGAGAAGAGCAGAGATATAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152280.x-435s1c1
Sequence:CCGGGCATCAGCATATACCCAGAGACTCGAGTCTCTGGGTATATGCTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152280.x-608s1c1
Sequence:CCGGATAGACCAATTACCCATCAAACTCGAGTTTGATGGGTAATTGGTCTATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152280.x-478s1c1
Sequence:CCGGCATCAAAGTGCGGAGAGACAACTCGAGTTGTCTCTCCGCACTTTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152280.x-857s1c1
Sequence:CCGGATCCTTCCTGACAAACGGCATCTCGAGATGCCGTTTGTCAGGAAGGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018804
SYT11 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XI
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018804.3-1376s21c1
Sequence:GTACCGGCACCGACCTTCTGCCTGATATCTCGAGATATCAGGCAGAAGGTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018804.3-1240s21c1
Sequence:GTACCGGTCACCGGTCTCTCAGGTAATCCTCGAGGATTACCTGAGAGACCGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018804.3-1549s21c1
Sequence:GTACCGGACAGTCTGAGCGAGTACTAACCTCGAGGTTAGTACTCGCTCAGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018804.3-1949s21c1
Sequence:GTACCGGATCAGGCTTCTCTGGGTTATTCTCGAGAATAACCCAGAGAAGCCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018804.2-1257s1c1
Sequence:CCGGCCATGTAAAGAAGTGCACTTTCTCGAGAAAGTGCACTTCTTTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018804.2-1869s1c1
Sequence:CCGGCCCTGAAATTGGCCTCTCTTTCTCGAGAAAGAGAGGCCAATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018804.2-559s1c1
Sequence:CCGGGCATCTTGTATGGACCAGTTACTCGAGTAACTGGTCCATACAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018804.2-369s1c1
Sequence:CCGGGCCATACAAGTTCATTCATATCTCGAGATATGAATGAACTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018804.2-367s1c1
Sequence:CCGGCCGCCATACAAGTTCATTCATCTCGAGATGAATGAACTTGTATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018804
SYT11 MISSION shRNA shRNA Plasmid DNA
synaptotagmin XI
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018804.3-1376s21c1
Sequence:GTACCGGCACCGACCTTCTGCCTGATATCTCGAGATATCAGGCAGAAGGTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018804.3-1240s21c1
Sequence:GTACCGGTCACCGGTCTCTCAGGTAATCCTCGAGGATTACCTGAGAGACCGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018804.3-1549s21c1
Sequence:GTACCGGACAGTCTGAGCGAGTACTAACCTCGAGGTTAGTACTCGCTCAGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018804.3-1949s21c1
Sequence:GTACCGGATCAGGCTTCTCTGGGTTATTCTCGAGAATAACCCAGAGAAGCCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018804.2-1257s1c1
Sequence:CCGGCCATGTAAAGAAGTGCACTTTCTCGAGAAAGTGCACTTCTTTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018804.2-1869s1c1
Sequence:CCGGCCCTGAAATTGGCCTCTCTTTCTCGAGAAAGAGAGGCCAATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018804.2-559s1c1
Sequence:CCGGGCATCTTGTATGGACCAGTTACTCGAGTAACTGGTCCATACAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018804.2-369s1c1
Sequence:CCGGGCCATACAAGTTCATTCATATCTCGAGATATGAATGAACTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018804.2-367s1c1
Sequence:CCGGCCGCCATACAAGTTCATTCATCTCGAGATGAATGAACTTGTATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018804
SYT11 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XI
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018804.3-1376s21c1
Sequence:GTACCGGCACCGACCTTCTGCCTGATATCTCGAGATATCAGGCAGAAGGTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018804.3-1240s21c1
Sequence:GTACCGGTCACCGGTCTCTCAGGTAATCCTCGAGGATTACCTGAGAGACCGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018804.3-1549s21c1
Sequence:GTACCGGACAGTCTGAGCGAGTACTAACCTCGAGGTTAGTACTCGCTCAGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018804.3-1949s21c1
Sequence:GTACCGGATCAGGCTTCTCTGGGTTATTCTCGAGAATAACCCAGAGAAGCCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018804.2-1257s1c1
Sequence:CCGGCCATGTAAAGAAGTGCACTTTCTCGAGAAAGTGCACTTCTTTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018804.2-1869s1c1
Sequence:CCGGCCCTGAAATTGGCCTCTCTTTCTCGAGAAAGAGAGGCCAATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018804.2-559s1c1
Sequence:CCGGGCATCTTGTATGGACCAGTTACTCGAGTAACTGGTCCATACAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018804.2-369s1c1
Sequence:CCGGGCCATACAAGTTCATTCATATCTCGAGATATGAATGAACTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018804.2-367s1c1
Sequence:CCGGCCGCCATACAAGTTCATTCATCTCGAGATGAATGAACTTGTATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks