EMAIL THIS PAGE TO A FRIEND

SYT12

synaptotagmin XII

Synonyms: SYT11 sytXII
UniProtKB ID: Q8IV01
Gene ID:
Human(91683) Summary: This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown that the encoded protein selectively modulates spontaneous synaptic-vesicle exocytosis and may also be involved in regulating calcium independent secretion in nonneuronal cells. Alternative splicing results in multiple transcript variants. The gene has previously been referred to as synaptotagmin XI but has been renamed synaptotagmin XII to be standard with mouse and rat official nomenclature.[provided by RefSeq, Apr 2010]
Mouse(171180) synaptotagmin XII
Rat(191595) synaptotagmin XII
fruit fly(32290) Synaptotagmin 12
Zebrafish(566397) synaptotagmin XII
dog(483703) synaptotagmin XII
domestic cat(101090292) synaptotagmin XII
Horse(100052905) synaptotagmin XII
chicken(422998) synaptotagmin XII
naked mole-rat(101710456) synaptotagmin XII
domestic guinea pig(100720056) synaptotagmin XII
cow(536820) synaptotagmin XII
sheep(101118234) synaptotagmin XII
201 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA011006 Anti-SYT12 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2107403 Anti-SYT12 antibody produced in rabbit affinity isolated antibody guinea pig, human, horse, rabbit
ELISA, western blot pricing
SAB5201041 Monoclonal Anti-Synaptotagmin-12 - Alkaline Phosphatase antibody produced in mouse clone S277-7, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201042 Monoclonal Anti-Synaptotagmin-12 - Apc antibody produced in mouse clone S277-7, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201033 Monoclonal Anti-Synaptotagmin-12 - Atto 390 antibody produced in mouse clone S277-7, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201034 Monoclonal Anti-Synaptotagmin-12 - Atto 488 antibody produced in mouse clone S277-7, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201035 Monoclonal Anti-Synaptotagmin-12 - Atto 565 antibody produced in mouse clone S277-7, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201036 Monoclonal Anti-Synaptotagmin-12 - Atto 594 antibody produced in mouse clone S277-7, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201037 Monoclonal Anti-Synaptotagmin-12 - Atto 633 antibody produced in mouse clone S277-7, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201038 Monoclonal Anti-Synaptotagmin-12 - Atto 655 antibody produced in mouse clone S277-7, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201039 Monoclonal Anti-Synaptotagmin-12 - Atto 680 antibody produced in mouse clone S277-7, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201040 Monoclonal Anti-Synaptotagmin-12 - Atto 700 antibody produced in mouse clone S277-7, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201043 Monoclonal Anti-Synaptotagmin-12 - Biotin antibody produced in mouse clone S277-7, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201044 Monoclonal Anti-Synaptotagmin-12 - Fitc antibody produced in mouse clone S277-7, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201045 Monoclonal Anti-Synaptotagmin-12 - Hrp antibody produced in mouse clone S277-7, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201046 Monoclonal Anti-Synaptotagmin-12 - Pe/Atto 594 antibody produced in mouse clone S277-7, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201047 Monoclonal Anti-Synaptotagmin-12 - Percp antibody produced in mouse clone S277-7, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201048 Monoclonal Anti-Synaptotagmin-12 - Rpe antibody produced in mouse clone S277-7, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201049 Monoclonal Anti-Synaptotagmin-12 - Streptavidin antibody produced in mouse clone S277-7, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201032 Monoclonal Anti-Synaptotagmin-12 antibody produced in mouse clone S277-7, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177963 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177963 Rosetta Predictions human pricing
NM_138835 Rosetta Predictions rat pricing
NM_134164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131908 predicted 533
2 SASI_Hs01_00131909 predicted 989
3 SASI_Hs01_00131910 predicted 875
4 SASI_Hs02_00369434 predicted 671
5 SASI_Hs02_00369435 predicted 477
6 SASI_Hs01_00131911 predicted 561
7 SASI_Hs01_00131913 predicted 501
8 SASI_Hs01_00131914 predicted 1098
9 SASI_Hs01_00131915 predicted 354
10 SASI_Hs01_00131916 predicted 240
11 SASI_Hs01_00131912 predicted 1386
12 SASI_Hs01_00131917 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061936 predicted 518
2 SASI_Rn01_00061937 predicted 509
3 SASI_Rn01_00061938 predicted 925
4 SASI_Rn01_00061939 predicted 1751
5 SASI_Rn01_00061940 predicted 1031
6 SASI_Rn02_00268212 predicted 511
7 SASI_Rn01_00061942 predicted 230
8 SASI_Rn01_00061943 predicted 851
9 SASI_Rn02_00268213 predicted 234
10 SASI_Rn01_00061945 predicted 515
11 SASI_Rn01_00061941 predicted 1296
12 SASI_Rn01_00061944 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339428 predicted 1035
2 SASI_Mm02_00339429 predicted 326
3 SASI_Mm02_00339430 predicted 1157
4 SASI_Mm02_00339431 predicted 1078
5 SASI_Mm02_00339432 predicted 388
6 SASI_Mm02_00339433 predicted 521
7 SASI_Mm02_00339434 predicted 1272
8 SASI_Mm02_00339435 predicted 865
9 SASI_Mm02_00339436 predicted 245
10 SASI_Mm02_00339437 predicted 1304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134164
SYT12 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XII
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134164.2-3104s1c1
Sequence:CCGGCCAGACTCTTTGTAATCCAATCTCGAGATTGGATTACAAAGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134164.2-525s1c1
Sequence:CCGGCTTAGTATAGAAGACACCTTTCTCGAGAAAGGTGTCTTCTATACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134164.2-524s1c1
Sequence:CCGGCCTTAGTATAGAAGACACCTTCTCGAGAAGGTGTCTTCTATACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134164.2-867s1c1
Sequence:CCGGGCCTATTCCATCTTCTTCGATCTCGAGATCGAAGAAGATGGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134164.2-1140s1c1
Sequence:CCGGGTTGTGGTGAAAGCCAAGAATCTCGAGATTCTTGGCTTTCACCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134164.5-1891s21c1
Sequence:GTACCGGGTGGTGGCAAGGCTAATATTACTCGAGTAATATTAGCCTTGCCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134164.5-1048s21c1
Sequence:GTACCGGATACTTGCAGGACCAGAATAACTCGAGTTATTCTGGTCCTGCAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134164.5-1748s21c1
Sequence:GTACCGGACCAGACTGACCTACTGTATTCTCGAGAATACAGTAGGTCAGTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134164.5-853s21c1
Sequence:GTACCGGGATCCAGAGGAATGCCTATTCCTCGAGGAATAGGCATTCCTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134164.5-513s21c1
Sequence:GTACCGGGCAAAGGCAGCCTTAGTATAGCTCGAGCTATACTAAGGCTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134164
SYT12 MISSION shRNA shRNA Plasmid DNA
synaptotagmin XII
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134164.2-3104s1c1
Sequence:CCGGCCAGACTCTTTGTAATCCAATCTCGAGATTGGATTACAAAGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134164.2-525s1c1
Sequence:CCGGCTTAGTATAGAAGACACCTTTCTCGAGAAAGGTGTCTTCTATACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134164.2-524s1c1
Sequence:CCGGCCTTAGTATAGAAGACACCTTCTCGAGAAGGTGTCTTCTATACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134164.2-867s1c1
Sequence:CCGGGCCTATTCCATCTTCTTCGATCTCGAGATCGAAGAAGATGGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134164.2-1140s1c1
Sequence:CCGGGTTGTGGTGAAAGCCAAGAATCTCGAGATTCTTGGCTTTCACCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134164.5-1891s21c1
Sequence:GTACCGGGTGGTGGCAAGGCTAATATTACTCGAGTAATATTAGCCTTGCCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134164.5-1048s21c1
Sequence:GTACCGGATACTTGCAGGACCAGAATAACTCGAGTTATTCTGGTCCTGCAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134164.5-1748s21c1
Sequence:GTACCGGACCAGACTGACCTACTGTATTCTCGAGAATACAGTAGGTCAGTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134164.5-853s21c1
Sequence:GTACCGGGATCCAGAGGAATGCCTATTCCTCGAGGAATAGGCATTCCTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134164.5-513s21c1
Sequence:GTACCGGGCAAAGGCAGCCTTAGTATAGCTCGAGCTATACTAAGGCTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134164
SYT12 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XII
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134164.2-3104s1c1
Sequence:CCGGCCAGACTCTTTGTAATCCAATCTCGAGATTGGATTACAAAGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134164.2-525s1c1
Sequence:CCGGCTTAGTATAGAAGACACCTTTCTCGAGAAAGGTGTCTTCTATACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134164.2-524s1c1
Sequence:CCGGCCTTAGTATAGAAGACACCTTCTCGAGAAGGTGTCTTCTATACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134164.2-867s1c1
Sequence:CCGGGCCTATTCCATCTTCTTCGATCTCGAGATCGAAGAAGATGGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134164.2-1140s1c1
Sequence:CCGGGTTGTGGTGAAAGCCAAGAATCTCGAGATTCTTGGCTTTCACCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134164.5-1891s21c1
Sequence:GTACCGGGTGGTGGCAAGGCTAATATTACTCGAGTAATATTAGCCTTGCCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134164.5-1048s21c1
Sequence:GTACCGGATACTTGCAGGACCAGAATAACTCGAGTTATTCTGGTCCTGCAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134164.5-1748s21c1
Sequence:GTACCGGACCAGACTGACCTACTGTATTCTCGAGAATACAGTAGGTCAGTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134164.5-853s21c1
Sequence:GTACCGGGATCCAGAGGAATGCCTATTCCTCGAGGAATAGGCATTCCTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134164.5-513s21c1
Sequence:GTACCGGGCAAAGGCAGCCTTAGTATAGCTCGAGCTATACTAAGGCTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177963
SYT12 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XII
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177963.2-880s1c1
Sequence:CCGGCTATTTACAGGACCAGAACAACTCGAGTTGTTCTGGTCCTGTAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060221    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_177963.2-775s1c1
Sequence:CCGGTTCTGTATTTGGCATCGATGACTCGAGTCATCGATGCCAAATACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060222    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_177963.2-776s1c1
Sequence:CCGGTCTGTATTTGGCATCGATGAGCTCGAGCTCATCGATGCCAAATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060220    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_177963.2-882s1c1
Sequence:CCGGATTTACAGGACCAGAACAAGGCTCGAGCCTTGTTCTGGTCCTGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177963.2-1792s21c1
Sequence:GTACCGGGAAACAGGAAGGGCCTCTTTGCTCGAGCAAAGAGGCCCTTCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-1111s21c1
Sequence:GTACCGGGTTCAACGAAGCCATGATCTTCTCGAGAAGATCATGGCTTCGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-660s21c1
Sequence:GTACCGGACGAGCAGATCGTGGGCATTTCTCGAGAAATGCCCACGATCTGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-685s21c1
Sequence:GTACCGGGATCCAGAGAAATGCCTACTCCTCGAGGAGTAGGCATTTCTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-620s21c1
Sequence:GTACCGGAGCTTCGAGTCCTGCTTCATGCTCGAGCATGAAGCAGGACTCGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-993s21c1
Sequence:GTACCGGTCATCTGGACCAACGACAAGACTCGAGTCTTGTCGTTGGTCCAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-357s21c1
Sequence:GTACCGGTCAGCATTGAGGACACCTTTGCTCGAGCAAAGGTGTCCTCAATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-1245s21c1
Sequence:GTACCGGGTGGCATGGGAACCACACATTCTCGAGAATGTGTGGTTCCCATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-485s21c1
Sequence:GTACCGGTCCTCCGTGAGCAACACCTTTCTCGAGAAAGGTGTTGCTCACGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177963
SYT12 MISSION shRNA shRNA Plasmid DNA
synaptotagmin XII
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177963.2-880s1c1
Sequence:CCGGCTATTTACAGGACCAGAACAACTCGAGTTGTTCTGGTCCTGTAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060221    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_177963.2-775s1c1
Sequence:CCGGTTCTGTATTTGGCATCGATGACTCGAGTCATCGATGCCAAATACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060222    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_177963.2-776s1c1
Sequence:CCGGTCTGTATTTGGCATCGATGAGCTCGAGCTCATCGATGCCAAATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060220    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_177963.2-882s1c1
Sequence:CCGGATTTACAGGACCAGAACAAGGCTCGAGCCTTGTTCTGGTCCTGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177963.2-1792s21c1
Sequence:GTACCGGGAAACAGGAAGGGCCTCTTTGCTCGAGCAAAGAGGCCCTTCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-1111s21c1
Sequence:GTACCGGGTTCAACGAAGCCATGATCTTCTCGAGAAGATCATGGCTTCGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-660s21c1
Sequence:GTACCGGACGAGCAGATCGTGGGCATTTCTCGAGAAATGCCCACGATCTGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-685s21c1
Sequence:GTACCGGGATCCAGAGAAATGCCTACTCCTCGAGGAGTAGGCATTTCTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-620s21c1
Sequence:GTACCGGAGCTTCGAGTCCTGCTTCATGCTCGAGCATGAAGCAGGACTCGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-993s21c1
Sequence:GTACCGGTCATCTGGACCAACGACAAGACTCGAGTCTTGTCGTTGGTCCAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-357s21c1
Sequence:GTACCGGTCAGCATTGAGGACACCTTTGCTCGAGCAAAGGTGTCCTCAATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-1245s21c1
Sequence:GTACCGGGTGGCATGGGAACCACACATTCTCGAGAATGTGTGGTTCCCATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-485s21c1
Sequence:GTACCGGTCCTCCGTGAGCAACACCTTTCTCGAGAAAGGTGTTGCTCACGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177963
SYT12 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XII
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177963.2-880s1c1
Sequence:CCGGCTATTTACAGGACCAGAACAACTCGAGTTGTTCTGGTCCTGTAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060221    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_177963.2-775s1c1
Sequence:CCGGTTCTGTATTTGGCATCGATGACTCGAGTCATCGATGCCAAATACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060222    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_177963.2-776s1c1
Sequence:CCGGTCTGTATTTGGCATCGATGAGCTCGAGCTCATCGATGCCAAATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060220    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_177963.2-882s1c1
Sequence:CCGGATTTACAGGACCAGAACAAGGCTCGAGCCTTGTTCTGGTCCTGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177963.2-1792s21c1
Sequence:GTACCGGGAAACAGGAAGGGCCTCTTTGCTCGAGCAAAGAGGCCCTTCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-1111s21c1
Sequence:GTACCGGGTTCAACGAAGCCATGATCTTCTCGAGAAGATCATGGCTTCGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-660s21c1
Sequence:GTACCGGACGAGCAGATCGTGGGCATTTCTCGAGAAATGCCCACGATCTGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-685s21c1
Sequence:GTACCGGGATCCAGAGAAATGCCTACTCCTCGAGGAGTAGGCATTTCTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-620s21c1
Sequence:GTACCGGAGCTTCGAGTCCTGCTTCATGCTCGAGCATGAAGCAGGACTCGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-993s21c1
Sequence:GTACCGGTCATCTGGACCAACGACAAGACTCGAGTCTTGTCGTTGGTCCAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-357s21c1
Sequence:GTACCGGTCAGCATTGAGGACACCTTTGCTCGAGCAAAGGTGTCCTCAATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-1245s21c1
Sequence:GTACCGGGTGGCATGGGAACCACACATTCTCGAGAATGTGTGGTTCCCATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177963.2-485s21c1
Sequence:GTACCGGTCCTCCGTGAGCAACACCTTTCTCGAGAAAGGTGTTGCTCACGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks