EMAIL THIS PAGE TO A FRIEND

SYT13

synaptotagmin XIII

UniProtKB ID: Q7L8C5, A8K4P4, D3DQP1, Q9BQS3, Q9H041, Q9P2C0
Gene ID:
Human(57586) Summary: This gene encodes a member of the large synaptotagmin protein family. Family members have an extracellular N-terminal transmembrane domain and a cytoplasmic C terminus with two tandem C2 domains (C2A and C2B). Synaptotogmin family members can form homo- and heteromeric complexes with each other. They also have different biochemical properties and developmental profiles, and patterns of tissue distribution. Synaptotagmins function as membrane traffickers in multicellular organisms. Two alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Mouse(80976) synaptotagmin XIII
Rat(80977) synaptotagmin XIII
cow(540545) synaptotagmin XIII
sheep(101116677) synaptotagmin XIII
domestic guinea pig(100723797) synaptotagmin XIII
naked mole-rat(101710338) synaptotagmin XIII
Domestic Rabbit(100347880) synaptotagmin XIII
Zebrafish(550345) synaptotagmin XIII
domestic cat(101084571) synaptotagmin XIII
dog(483643) synaptotagmin XIII
chicken(423175) synaptotagmin XIII
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030725 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030725 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030725 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020826 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020826 Rosetta Predictions human pricing
NM_030839 Rosetta Predictions rat pricing
NM_030725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242013 predicted 1057
2 SASI_Hs01_00242014 predicted 404
3 SASI_Hs02_00354053 predicted 520
4 SASI_Hs01_00242015 predicted 1542
5 SASI_Hs01_00242017 predicted 414
6 SASI_Hs01_00242018 predicted 1639
7 SASI_Hs01_00242019 predicted 350
8 SASI_Hs01_00242020 predicted 627
9 SASI_Hs02_00354054 predicted 471
10 SASI_Hs02_00354055 predicted 1621
11 SASI_Hs01_00242011 predicted 1034
12 SASI_Hs01_00242012 predicted 555
13 SASI_Hs01_00242016 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030839 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094350 predicted 949
2 SASI_Rn01_00094351 predicted 399
3 SASI_Rn01_00094352 predicted 863
4 SASI_Rn01_00094353 predicted 507
5 SASI_Rn01_00094356 predicted 343
6 SASI_Rn01_00094357 predicted 929
7 SASI_Rn01_00094358 predicted 528
8 SASI_Rn02_00264064 predicted 620
9 SASI_Rn01_00094359 predicted 218
10 SASI_Rn02_00264065 predicted 613
11 SASI_Rn01_00094354 predicted 571
12 SASI_Rn01_00094355 predicted 1256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102075 predicted 1498
2 SASI_Mm01_00102076 predicted 1508
3 SASI_Mm02_00336913 predicted 1385
4 SASI_Mm01_00102077 predicted 1676
5 SASI_Mm01_00102078 predicted 1591
6 SASI_Mm01_00102079 predicted 1013
7 SASI_Mm01_00102074 predicted 483
8 SASI_Mm01_00102082 predicted 586
9 SASI_Mm02_00336914 predicted 1794
10 SASI_Mm02_00336915 predicted 1402
11 SASI_Mm01_00102080 predicted 1828
12 SASI_Mm01_00102081 predicted 1077
13 SASI_Mm01_00102083 predicted 1673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030725
SYT13 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XIII
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030725.4-1301s21c1
Sequence:GTACCGGCCACTGGGAGGAGATGCTAAACTCGAGTTTAGCATCTCCTCCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030725.4-595s21c1
Sequence:GTACCGGAGAAGAAGGCTGAGTTATTTGCTCGAGCAAATAACTCAGCCTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030725.4-1446s21c1
Sequence:GTACCGGTGCTCTGTCCACATGCCTATACTCGAGTATAGGCATGTGGACAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030725.4-316s21c1
Sequence:GTACCGGTTAAGTTCCCGGACATCTATGCTCGAGCATAGATGTCCGGGAACTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030725.4-1153s21c1
Sequence:GTACCGGGGAACGAGATGATCATGTTTGCTCGAGCAAACATGATCATCTCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030725.2-3589s1c1
Sequence:CCGGCCAGGATCTTACATTCTGATTCTCGAGAATCAGAATGTAAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030725.2-484s1c1
Sequence:CCGGCGTCCTCAGAACGGTGTAGTTCTCGAGAACTACACCGTTCTGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030725.2-260s1c1
Sequence:CCGGCGGCCCAACAGTTCAACATTACTCGAGTAATGTTGAACTGTTGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030725.2-592s1c1
Sequence:CCGGGACCAGAAGAAGGCTGAGTTACTCGAGTAACTCAGCCTTCTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030725.2-593s1c1
Sequence:CCGGACCAGAAGAAGGCTGAGTTATCTCGAGATAACTCAGCCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030725
SYT13 MISSION shRNA shRNA Plasmid DNA
synaptotagmin XIII
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030725.4-1301s21c1
Sequence:GTACCGGCCACTGGGAGGAGATGCTAAACTCGAGTTTAGCATCTCCTCCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030725.4-595s21c1
Sequence:GTACCGGAGAAGAAGGCTGAGTTATTTGCTCGAGCAAATAACTCAGCCTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030725.4-1446s21c1
Sequence:GTACCGGTGCTCTGTCCACATGCCTATACTCGAGTATAGGCATGTGGACAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030725.4-316s21c1
Sequence:GTACCGGTTAAGTTCCCGGACATCTATGCTCGAGCATAGATGTCCGGGAACTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030725.4-1153s21c1
Sequence:GTACCGGGGAACGAGATGATCATGTTTGCTCGAGCAAACATGATCATCTCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030725.2-3589s1c1
Sequence:CCGGCCAGGATCTTACATTCTGATTCTCGAGAATCAGAATGTAAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030725.2-484s1c1
Sequence:CCGGCGTCCTCAGAACGGTGTAGTTCTCGAGAACTACACCGTTCTGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030725.2-260s1c1
Sequence:CCGGCGGCCCAACAGTTCAACATTACTCGAGTAATGTTGAACTGTTGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030725.2-592s1c1
Sequence:CCGGGACCAGAAGAAGGCTGAGTTACTCGAGTAACTCAGCCTTCTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030725.2-593s1c1
Sequence:CCGGACCAGAAGAAGGCTGAGTTATCTCGAGATAACTCAGCCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030725
SYT13 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XIII
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030725.4-1301s21c1
Sequence:GTACCGGCCACTGGGAGGAGATGCTAAACTCGAGTTTAGCATCTCCTCCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030725.4-595s21c1
Sequence:GTACCGGAGAAGAAGGCTGAGTTATTTGCTCGAGCAAATAACTCAGCCTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030725.4-1446s21c1
Sequence:GTACCGGTGCTCTGTCCACATGCCTATACTCGAGTATAGGCATGTGGACAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030725.4-316s21c1
Sequence:GTACCGGTTAAGTTCCCGGACATCTATGCTCGAGCATAGATGTCCGGGAACTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030725.4-1153s21c1
Sequence:GTACCGGGGAACGAGATGATCATGTTTGCTCGAGCAAACATGATCATCTCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030725.2-3589s1c1
Sequence:CCGGCCAGGATCTTACATTCTGATTCTCGAGAATCAGAATGTAAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030725.2-484s1c1
Sequence:CCGGCGTCCTCAGAACGGTGTAGTTCTCGAGAACTACACCGTTCTGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030725.2-260s1c1
Sequence:CCGGCGGCCCAACAGTTCAACATTACTCGAGTAATGTTGAACTGTTGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030725.2-592s1c1
Sequence:CCGGGACCAGAAGAAGGCTGAGTTACTCGAGTAACTCAGCCTTCTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030725.2-593s1c1
Sequence:CCGGACCAGAAGAAGGCTGAGTTATCTCGAGATAACTCAGCCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020826
VALIDATED
SYT13 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XIII
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-1143s21c1
Sequence:CCGGGCTGAAGAAGAAGCAGACTAACTCGAGTTAGTCTGCTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-301s21c1
Sequence:CCGGGCACAACAGTTCAATGTTAAACTCGAGTTTAACATTGAACTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-621s21c1
Sequence:CCGGCCTGGACTATGACTGTCAGAACTCGAGTTCTGACAGTCATAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-1036s21c1
Sequence:CCGGCTCCTGGTGGTGCTGATTAAACTCGAGTTTAATCAGCACCACCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020826.2-419s21c1
Sequence:CCGGCAGACTATTCACTGAGGTCTACTCGAGTAGACCTCAGTGAATAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-987s21c1
Sequence:GTACCGGAGCTGGAGAGGTCCTACTATCCTCGAGGATAGTAGGACCTCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-1066s1c1
Sequence:CCGGGCTGAAGAAGAAGCAGACTAACTCGAGTTAGTCTGCTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-342s1c1
Sequence:CCGGCAGACTATTCACTGAGGTCTACTCGAGTAGACCTCAGTGAATAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-959s1c1
Sequence:CCGGCTCCTGGTGGTGCTGATTAAACTCGAGTTTAATCAGCACCACCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-224s1c1
Sequence:CCGGGCACAACAGTTCAATGTTAAACTCGAGTTTAACATTGAACTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-544s1c1
Sequence:CCGGCCTGGACTATGACTGTCAGAACTCGAGTTCTGACAGTCATAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020826
VALIDATED
SYT13 MISSION shRNA shRNA Plasmid DNA
synaptotagmin XIII
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-1143s21c1
Sequence:CCGGGCTGAAGAAGAAGCAGACTAACTCGAGTTAGTCTGCTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-301s21c1
Sequence:CCGGGCACAACAGTTCAATGTTAAACTCGAGTTTAACATTGAACTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-621s21c1
Sequence:CCGGCCTGGACTATGACTGTCAGAACTCGAGTTCTGACAGTCATAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-1036s21c1
Sequence:CCGGCTCCTGGTGGTGCTGATTAAACTCGAGTTTAATCAGCACCACCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020826.2-419s21c1
Sequence:CCGGCAGACTATTCACTGAGGTCTACTCGAGTAGACCTCAGTGAATAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-987s21c1
Sequence:GTACCGGAGCTGGAGAGGTCCTACTATCCTCGAGGATAGTAGGACCTCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-1066s1c1
Sequence:CCGGGCTGAAGAAGAAGCAGACTAACTCGAGTTAGTCTGCTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-342s1c1
Sequence:CCGGCAGACTATTCACTGAGGTCTACTCGAGTAGACCTCAGTGAATAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-959s1c1
Sequence:CCGGCTCCTGGTGGTGCTGATTAAACTCGAGTTTAATCAGCACCACCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-224s1c1
Sequence:CCGGGCACAACAGTTCAATGTTAAACTCGAGTTTAACATTGAACTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-544s1c1
Sequence:CCGGCCTGGACTATGACTGTCAGAACTCGAGTTCTGACAGTCATAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020826
VALIDATED
SYT13 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XIII
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-1143s21c1
Sequence:CCGGGCTGAAGAAGAAGCAGACTAACTCGAGTTAGTCTGCTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-301s21c1
Sequence:CCGGGCACAACAGTTCAATGTTAAACTCGAGTTTAACATTGAACTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-621s21c1
Sequence:CCGGCCTGGACTATGACTGTCAGAACTCGAGTTCTGACAGTCATAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-1036s21c1
Sequence:CCGGCTCCTGGTGGTGCTGATTAAACTCGAGTTTAATCAGCACCACCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020826.2-419s21c1
Sequence:CCGGCAGACTATTCACTGAGGTCTACTCGAGTAGACCTCAGTGAATAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020826.2-987s21c1
Sequence:GTACCGGAGCTGGAGAGGTCCTACTATCCTCGAGGATAGTAGGACCTCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-1066s1c1
Sequence:CCGGGCTGAAGAAGAAGCAGACTAACTCGAGTTAGTCTGCTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-342s1c1
Sequence:CCGGCAGACTATTCACTGAGGTCTACTCGAGTAGACCTCAGTGAATAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-959s1c1
Sequence:CCGGCTCCTGGTGGTGCTGATTAAACTCGAGTTTAATCAGCACCACCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-224s1c1
Sequence:CCGGGCACAACAGTTCAATGTTAAACTCGAGTTTAACATTGAACTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020826.1-544s1c1
Sequence:CCGGCCTGGACTATGACTGTCAGAACTCGAGTTCTGACAGTCATAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks