EMAIL THIS PAGE TO A FRIEND

SYT14

synaptotagmin XIV

Synonyms: SCAR11 sytXIV
Gene ID:
Human(255928) Summary: This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate membrane trafficking in synaptic transmission. The encoded protein is a calcium-independent synaptotagmin. Mutations in this gene are a cause of autosomal recessive spinocerebellar ataxia-11 (SCAR11), and a t(1;3) translocation of this gene has been associated with neurodevelopmental abnormalities. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 4. [provided by RefSeq, Dec 2011]
Mouse(329324) synaptotagmin XIV
Rat(684293) synaptotagmin XIV
fruit fly(40544) Synaptotagmin 14
Horse(100056174) synaptotagmin XIV
domestic cat(101093660) synaptotagmin XIV
dog(480016) synaptotagmin XIV
chicken(428566) synaptotagmin XIV
Domestic Rabbit(100349014) synaptotagmin XIV
naked mole-rat(101710158) synaptotagmin XIV
domestic guinea pig(100730561) synaptotagmin XIV
sheep(101121028) synaptotagmin XIV
173 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036963 Anti-SYT14 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153262 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153262 Rosetta Predictions human pricing
XM_001069763 Rosetta Predictions rat pricing
NM_181546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185472 predicted 959
2 SASI_Hs01_00185473 predicted 1065
3 SASI_Hs01_00185474 predicted 698
4 SASI_Hs01_00185475 predicted 1288
5 SASI_Hs01_00185476 predicted 339
6 SASI_Hs02_00367131 predicted 777
7 SASI_Hs01_00185478 predicted 471
8 SASI_Hs01_00185479 predicted 799
9 SASI_Hs02_00367132 predicted 357
10 SASI_Hs01_00185480 predicted 884
11 SASI_Hs01_00185477 predicted 1273
12 SASI_Hs01_00185481 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329193 predicted 854
2 SASI_Rn02_00329194 predicted 466
3 SASI_Rn02_00329195 predicted 709
4 SASI_Rn02_00329196 predicted 1541
5 SASI_Rn02_00329197 predicted 545
6 SASI_Rn02_00329198 predicted 726
7 SASI_Rn02_00329199 predicted 1830
8 SASI_Rn02_00329200 predicted 1409
9 SASI_Rn02_00329201 predicted 1087
10 SASI_Rn02_00329202 predicted 1293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139417 predicted 417
2 SASI_Mm01_00139418 predicted 710
3 SASI_Mm01_00139419 predicted 1413
4 SASI_Mm01_00139420 predicted 1160
5 SASI_Mm01_00139421 predicted 1312
6 SASI_Mm01_00139422 predicted 1036
7 SASI_Mm01_00139423 predicted 330
8 SASI_Mm01_00139424 predicted 915
9 SASI_Mm02_00349826 predicted 498
10 SASI_Mm01_00139425 predicted 244
11 SASI_Mm01_00139426 predicted 1196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181546
SYT14 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XIV
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-1056s1c1
Sequence:CCGGCCACGTTGAATCCGAGATGATCTCGAGATCATCTCGGATTCAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-965s1c1
Sequence:CCGGACCTTGTTCTTCTACCTATAACTCGAGTTATAGGTAGAAGAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-1087s1c1
Sequence:CCGGGCAGTTAGGTTTAGACTATATCTCGAGATATAGTCTAAACCTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-913s1c1
Sequence:CCGGGTCACAGACATTCCAACATATCTCGAGATATGTTGGAATGTCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-504s1c1
Sequence:CCGGCGGAAACTGCATTCAGAGAATCTCGAGATTCTCTGAATGCAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181546.2-339s21c1
Sequence:GTACCGGAGATGAAGCACTGGGTAAATACTCGAGTATTTACCCAGTGCTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181546.2-242s21c1
Sequence:GTACCGGATCTTGGTTCAGGATACAATACTCGAGTATTGTATCCTGAACCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181546.2-705s21c1
Sequence:GTACCGGGGCCGAGAGCTATCACAATAACTCGAGTTATTGTGATAGCTCTCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181546
SYT14 MISSION shRNA shRNA Plasmid DNA
synaptotagmin XIV
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-1056s1c1
Sequence:CCGGCCACGTTGAATCCGAGATGATCTCGAGATCATCTCGGATTCAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-965s1c1
Sequence:CCGGACCTTGTTCTTCTACCTATAACTCGAGTTATAGGTAGAAGAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-1087s1c1
Sequence:CCGGGCAGTTAGGTTTAGACTATATCTCGAGATATAGTCTAAACCTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-913s1c1
Sequence:CCGGGTCACAGACATTCCAACATATCTCGAGATATGTTGGAATGTCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-504s1c1
Sequence:CCGGCGGAAACTGCATTCAGAGAATCTCGAGATTCTCTGAATGCAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181546.2-339s21c1
Sequence:GTACCGGAGATGAAGCACTGGGTAAATACTCGAGTATTTACCCAGTGCTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181546.2-242s21c1
Sequence:GTACCGGATCTTGGTTCAGGATACAATACTCGAGTATTGTATCCTGAACCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181546.2-705s21c1
Sequence:GTACCGGGGCCGAGAGCTATCACAATAACTCGAGTTATTGTGATAGCTCTCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181546
SYT14 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XIV
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-1056s1c1
Sequence:CCGGCCACGTTGAATCCGAGATGATCTCGAGATCATCTCGGATTCAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-965s1c1
Sequence:CCGGACCTTGTTCTTCTACCTATAACTCGAGTTATAGGTAGAAGAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-1087s1c1
Sequence:CCGGGCAGTTAGGTTTAGACTATATCTCGAGATATAGTCTAAACCTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-913s1c1
Sequence:CCGGGTCACAGACATTCCAACATATCTCGAGATATGTTGGAATGTCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181546.2-504s1c1
Sequence:CCGGCGGAAACTGCATTCAGAGAATCTCGAGATTCTCTGAATGCAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181546.2-339s21c1
Sequence:GTACCGGAGATGAAGCACTGGGTAAATACTCGAGTATTTACCCAGTGCTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181546.2-242s21c1
Sequence:GTACCGGATCTTGGTTCAGGATACAATACTCGAGTATTGTATCCTGAACCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181546.2-705s21c1
Sequence:GTACCGGGGCCGAGAGCTATCACAATAACTCGAGTTATTGTGATAGCTCTCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153262
SYT14 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XIV
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153262.x-1753s1c1
Sequence:CCGGAGTCCCATTAGAAGAGCTGTTCTCGAGAACAGCTCTTCTAATGGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153262.x-1146s1c1
Sequence:CCGGCCTGTGATATTGGAACCTTCTCTCGAGAGAAGGTTCCAATATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153262.x-917s1c1
Sequence:CCGGCCTTGTTCTTCTACCTATAAACTCGAGTTTATAGGTAGAAGAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153262.x-319s1c1
Sequence:CCGGCCTTATCCAGAACACACAATTCTCGAGAATTGTGTGTTCTGGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153262.x-1044s1c1
Sequence:CCGGCGGTTTAGACTGTATGGTGTACTCGAGTACACCATACAGTCTAAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-924s21c1
Sequence:GTACCGGCACAGACATCCCAACATATAACTCGAGTTATATGTTGGGATGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1535s21c1
Sequence:GTACCGGTCTTTCAAGTGGCCCTATTTCCTCGAGGAAATAGGGCCACTTGAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1308s21c1
Sequence:GTACCGGACATGGCTCAGTTCCAGAAATCTCGAGATTTCTGGAACTGAGCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-976s21c1
Sequence:CCGGCTTGTTCTTCTACCTATAAAGCTCGAGCTTTATAGGTAGAAGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1204s21c1
Sequence:CCGGCCTGTGATATTGGAACCTTCTCTCGAGAGAAGGTTCCAATATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153262.2-2196s21c1
Sequence:CCGGAGTTCTCCAACTCTATCATAACTCGAGTTATGATAGAGTTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1502s21c1
Sequence:CCGGGGCAGCCAAATCCAGTATATACTCGAGTATATACTGGATTTGGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-348s21c1
Sequence:CCGGAGATGAAGCGCTGGGTAAATACTCGAGTATTTACCCAGCGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1088s21c1
Sequence:GTACCGGGAAATTATGCAGTTCGGTTTACTCGAGTAAACCGAACTGCATAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153262
SYT14 MISSION shRNA shRNA Plasmid DNA
synaptotagmin XIV
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153262.x-1753s1c1
Sequence:CCGGAGTCCCATTAGAAGAGCTGTTCTCGAGAACAGCTCTTCTAATGGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153262.x-1146s1c1
Sequence:CCGGCCTGTGATATTGGAACCTTCTCTCGAGAGAAGGTTCCAATATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153262.x-917s1c1
Sequence:CCGGCCTTGTTCTTCTACCTATAAACTCGAGTTTATAGGTAGAAGAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153262.x-319s1c1
Sequence:CCGGCCTTATCCAGAACACACAATTCTCGAGAATTGTGTGTTCTGGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153262.x-1044s1c1
Sequence:CCGGCGGTTTAGACTGTATGGTGTACTCGAGTACACCATACAGTCTAAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-924s21c1
Sequence:GTACCGGCACAGACATCCCAACATATAACTCGAGTTATATGTTGGGATGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1535s21c1
Sequence:GTACCGGTCTTTCAAGTGGCCCTATTTCCTCGAGGAAATAGGGCCACTTGAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1308s21c1
Sequence:GTACCGGACATGGCTCAGTTCCAGAAATCTCGAGATTTCTGGAACTGAGCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-976s21c1
Sequence:CCGGCTTGTTCTTCTACCTATAAAGCTCGAGCTTTATAGGTAGAAGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1204s21c1
Sequence:CCGGCCTGTGATATTGGAACCTTCTCTCGAGAGAAGGTTCCAATATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153262.2-2196s21c1
Sequence:CCGGAGTTCTCCAACTCTATCATAACTCGAGTTATGATAGAGTTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1502s21c1
Sequence:CCGGGGCAGCCAAATCCAGTATATACTCGAGTATATACTGGATTTGGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-348s21c1
Sequence:CCGGAGATGAAGCGCTGGGTAAATACTCGAGTATTTACCCAGCGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1088s21c1
Sequence:GTACCGGGAAATTATGCAGTTCGGTTTACTCGAGTAAACCGAACTGCATAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153262
SYT14 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XIV
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153262.x-1753s1c1
Sequence:CCGGAGTCCCATTAGAAGAGCTGTTCTCGAGAACAGCTCTTCTAATGGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153262.x-1146s1c1
Sequence:CCGGCCTGTGATATTGGAACCTTCTCTCGAGAGAAGGTTCCAATATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153262.x-917s1c1
Sequence:CCGGCCTTGTTCTTCTACCTATAAACTCGAGTTTATAGGTAGAAGAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153262.x-319s1c1
Sequence:CCGGCCTTATCCAGAACACACAATTCTCGAGAATTGTGTGTTCTGGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153262.x-1044s1c1
Sequence:CCGGCGGTTTAGACTGTATGGTGTACTCGAGTACACCATACAGTCTAAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-924s21c1
Sequence:GTACCGGCACAGACATCCCAACATATAACTCGAGTTATATGTTGGGATGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1535s21c1
Sequence:GTACCGGTCTTTCAAGTGGCCCTATTTCCTCGAGGAAATAGGGCCACTTGAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1308s21c1
Sequence:GTACCGGACATGGCTCAGTTCCAGAAATCTCGAGATTTCTGGAACTGAGCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-976s21c1
Sequence:CCGGCTTGTTCTTCTACCTATAAAGCTCGAGCTTTATAGGTAGAAGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1204s21c1
Sequence:CCGGCCTGTGATATTGGAACCTTCTCTCGAGAGAAGGTTCCAATATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153262.2-2196s21c1
Sequence:CCGGAGTTCTCCAACTCTATCATAACTCGAGTTATGATAGAGTTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1502s21c1
Sequence:CCGGGGCAGCCAAATCCAGTATATACTCGAGTATATACTGGATTTGGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-348s21c1
Sequence:CCGGAGATGAAGCGCTGGGTAAATACTCGAGTATTTACCCAGCGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153262.2-1088s21c1
Sequence:GTACCGGGAAATTATGCAGTTCGGTTTACTCGAGTAAACCGAACTGCATAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks