EMAIL THIS PAGE TO A FRIEND

SYT14L

synaptotagmin XIV-like

Synonyms: CHR415SYT SYTDEP
Species: Human SYT14L(401135)
UniProtKB ID: Q58G82, A2RTZ8, Q9BQR7
Gene ID:
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001014372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001014372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001014372 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128661 MISSION® esiRNA esiRNA human SYT14L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014372 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103844 predicted 760
2 SASI_Hs01_00103845 predicted 772
3 SASI_Hs01_00103846 predicted 774
4 SASI_Hs01_00103847 predicted 342
5 SASI_Hs01_00103848 predicted 340
6 SASI_Hs02_00306532 predicted 467
7 SASI_Hs01_00103849 predicted 619
8 SASI_Hs01_00103850 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014372
SYT14L MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XIV-like
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-487s1c1
Sequence:CCGGGAGATGTCCAAATGCAAGATACTCGAGTATCTTGCATTTGGACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-343s1c1
Sequence:CCGGGAAATTCTCATTAGCCTGCTTCTCGAGAAGCAGGCTAATGAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-383s1c1
Sequence:CCGGGACTATCAGCAGAAGTGATAACTCGAGTTATCACTTCTGCTGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-229s1c1
Sequence:CCGGCAAGGAACAATTCACAAGATACTCGAGTATCTTGTGAATTGTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-466s1c1
Sequence:CCGGCTACGGAAATCCATGGATCAACTCGAGTTGATCCATGGATTTCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-522s1c1
Sequence:CCGGGCGGCCAAATCCAGTATACAACTCGAGTTGTATACTGGATTTGGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014372
SYT14L MISSION shRNA shRNA Plasmid DNA
synaptotagmin XIV-like
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-487s1c1
Sequence:CCGGGAGATGTCCAAATGCAAGATACTCGAGTATCTTGCATTTGGACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-343s1c1
Sequence:CCGGGAAATTCTCATTAGCCTGCTTCTCGAGAAGCAGGCTAATGAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-383s1c1
Sequence:CCGGGACTATCAGCAGAAGTGATAACTCGAGTTATCACTTCTGCTGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-229s1c1
Sequence:CCGGCAAGGAACAATTCACAAGATACTCGAGTATCTTGTGAATTGTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-466s1c1
Sequence:CCGGCTACGGAAATCCATGGATCAACTCGAGTTGATCCATGGATTTCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-522s1c1
Sequence:CCGGGCGGCCAAATCCAGTATACAACTCGAGTTGTATACTGGATTTGGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014372
SYT14L MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XIV-like
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-487s1c1
Sequence:CCGGGAGATGTCCAAATGCAAGATACTCGAGTATCTTGCATTTGGACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-343s1c1
Sequence:CCGGGAAATTCTCATTAGCCTGCTTCTCGAGAAGCAGGCTAATGAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-383s1c1
Sequence:CCGGGACTATCAGCAGAAGTGATAACTCGAGTTATCACTTCTGCTGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-229s1c1
Sequence:CCGGCAAGGAACAATTCACAAGATACTCGAGTATCTTGTGAATTGTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-466s1c1
Sequence:CCGGCTACGGAAATCCATGGATCAACTCGAGTTGATCCATGGATTTCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014372.1-522s1c1
Sequence:CCGGGCGGCCAAATCCAGTATACAACTCGAGTTGTATACTGGATTTGGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks