EMAIL THIS PAGE TO A FRIEND

SYT15

synaptotagmin XV

Synonyms: CHR10SYT sytXV
UniProtKB ID: Q9BQS2, A5D6W8, Q5VY53, Q5VY55, Q7Z439, Q7Z440
Gene ID:
Human(83849) Summary: This gene encodes a member of the Synaptotagmin (Syt) family of membrane trafficking proteins. Members of this family contain a transmembrane region and a C-terminal-type tandem C2 domain. Unlike related family members, the encoded protein may be involved in membrane trafficking in non-neuronal tissues. Two trancript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(319508) synaptotagmin XV
Rat(306285) synaptotagmin XV
Zebrafish(798021) synaptotagmin XV
domestic cat(101090552) synaptotagmin XV
Horse(100064042) synaptotagmin XV
dog(489080) synaptotagmin XV
chicken(423614) synaptotagmin XV
cow(529391) synaptotagmin XV
sheep(101115343) synaptotagmin XV
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031912 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176931 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176931 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176931 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103581 MISSION® esiRNA esiRNA human SYT15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031912 Rosetta Predictions human pricing
NM_181519 Rosetta Predictions human pricing
NM_181632 Rosetta Predictions rat pricing
NM_176931 Rosetta Predictions mouse pricing
NM_181529 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120332 predicted 601
2 SASI_Hs01_00120333 predicted 777
3 SASI_Hs01_00120334 predicted 524
4 SASI_Hs01_00120335 predicted 547
5 SASI_Hs01_00120336 predicted 768
6 SASI_Hs01_00120337 predicted 978
7 SASI_Hs01_00120338 predicted 770
8 SASI_Hs01_00120339 predicted 998
9 SASI_Hs01_00120340 predicted 830
10 SASI_Hs01_00120341 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235596 predicted 603
2 SASI_Hs01_00235597 predicted 777
3 SASI_Hs01_00235598 predicted 525
4 SASI_Hs01_00235599 predicted 541
5 SASI_Hs01_00235600 predicted 772
6 SASI_Hs01_00235601 predicted 973
7 SASI_Hs01_00235602 predicted 769
8 SASI_Hs01_00235603 predicted 995
9 SASI_Hs01_00235604 predicted 828
10 SASI_Hs01_00235605 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181632 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119672 predicted 1579
2 SASI_Rn02_00269770 predicted 1148
3 SASI_Rn01_00119673 predicted 412
4 SASI_Rn01_00119675 predicted 1262
5 SASI_Rn01_00119676 predicted 278
6 SASI_Rn01_00119677 predicted 1413
7 SASI_Rn01_00119678 predicted 1595
8 SASI_Rn01_00119679 predicted 730
9 SASI_Rn01_00119680 predicted 1453
10 SASI_Rn02_00269771 predicted 935
11 SASI_Rn01_00119674 predicted 1498
12 SASI_Rn01_00119681 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346823 predicted 194
2 SASI_Mm02_00346824 predicted 197
3 SASI_Mm02_00346825 predicted 862
4 SASI_Mm02_00346826 predicted 203
5 SASI_Mm02_00346827 predicted 200
6 SASI_Mm02_00346828 predicted 822
7 SASI_Mm02_00346829 predicted 854
8 SASI_Mm02_00346830 predicted 849
9 SASI_Mm02_00346831 predicted 300
10 SASI_Mm02_00346832 predicted 893
11 SASI_Mm01_00026285 predicted 941
12 SASI_Mm01_00026286 predicted 948
13 SASI_Mm01_00026287 predicted 317
14 SASI_Mm01_00026288 predicted 723
15 SASI_Mm01_00026289 predicted 367
16 SASI_Mm01_00026290 predicted 824
17 SASI_Mm01_00026291 predicted 541
18 SASI_Mm01_00026292 predicted 786
19 SASI_Mm01_00026293 predicted 451
20 SASI_Mm01_00026294 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349796 predicted 321
2 SASI_Mm02_00349797 predicted 322
3 SASI_Mm02_00349798 predicted 996
4 SASI_Mm02_00349799 predicted 333
5 SASI_Mm02_00349800 predicted 323
6 SASI_Mm02_00349801 predicted 951
7 SASI_Mm02_00349802 predicted 979
8 SASI_Mm02_00349803 predicted 979
9 SASI_Mm02_00349804 predicted 419
10 SASI_Mm02_00349805 predicted 1015
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031912
SYT15 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XV
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-1179s1c1
Sequence:CCGGCCCTGTGTACAATGAGACCTTCTCGAGAAGGTCTCATTGTACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-603s1c1
Sequence:CCGGGCTGTGGTTCTCGGTGGAATACTCGAGTATTCCACCGAGAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-1084s1c1
Sequence:CCGGAGAGGCATTGTCAGTGTGTTTCTCGAGAAACACACTGACAATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-744s1c1
Sequence:CCGGCCAATCCAAGACCAAACGCAACTCGAGTTGCGTTTGGTCTTGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-901s1c1
Sequence:CCGGCCCTTGAAGAATGAGACCCTACTCGAGTAGGGTCTCATTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-745s21c1
Sequence:GTACCGGCAATCCAAGACCAAACGCAAACTCGAGTTTGCGTTTGGTCTTGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-1085s21c1
Sequence:GTACCGGGAGGCATTGTCAGTGTGTTTGCTCGAGCAAACACACTGACAATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-531s21c1
Sequence:GTACCGGCATCAACCCAGAGCTGTACAACTCGAGTTGTACAGCTCTGGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-831s21c1
Sequence:GTACCGGGGTGCTGAAGTTCTCCGTCTACTCGAGTAGACGGAGAACTTCAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-904s21c1
Sequence:GTACCGGTTGAAGAATGAGACCCTAGTGCTCGAGCACTAGGGTCTCATTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-803s21c1
Sequence:GTACCGGAGGTGTCCAGCAAGACCATCACTCGAGTGATGGTCTTGCTGGACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031912.3-1770s21c1
Sequence:GTACCGGGAATGGACCTGCAGGGTAAACCTCGAGGTTTACCCTGCAGGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-605s21c1
Sequence:GTACCGGTGTGGTTCTCGGTGGAATATGCTCGAGCATATTCCACCGAGAACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-1120s21c1
Sequence:GTACCGGATGAACCACAACAAGTTTGTCCTCGAGGACAAACTTGTTGTGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-1172s21c1
Sequence:GTACCGGCCATCAACCCTGTGTACAATGCTCGAGCATTGTACACAGGGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031912
SYT15 MISSION shRNA shRNA Plasmid DNA
synaptotagmin XV
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-1179s1c1
Sequence:CCGGCCCTGTGTACAATGAGACCTTCTCGAGAAGGTCTCATTGTACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-603s1c1
Sequence:CCGGGCTGTGGTTCTCGGTGGAATACTCGAGTATTCCACCGAGAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-1084s1c1
Sequence:CCGGAGAGGCATTGTCAGTGTGTTTCTCGAGAAACACACTGACAATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-744s1c1
Sequence:CCGGCCAATCCAAGACCAAACGCAACTCGAGTTGCGTTTGGTCTTGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-901s1c1
Sequence:CCGGCCCTTGAAGAATGAGACCCTACTCGAGTAGGGTCTCATTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-745s21c1
Sequence:GTACCGGCAATCCAAGACCAAACGCAAACTCGAGTTTGCGTTTGGTCTTGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-1085s21c1
Sequence:GTACCGGGAGGCATTGTCAGTGTGTTTGCTCGAGCAAACACACTGACAATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-531s21c1
Sequence:GTACCGGCATCAACCCAGAGCTGTACAACTCGAGTTGTACAGCTCTGGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-831s21c1
Sequence:GTACCGGGGTGCTGAAGTTCTCCGTCTACTCGAGTAGACGGAGAACTTCAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-904s21c1
Sequence:GTACCGGTTGAAGAATGAGACCCTAGTGCTCGAGCACTAGGGTCTCATTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-803s21c1
Sequence:GTACCGGAGGTGTCCAGCAAGACCATCACTCGAGTGATGGTCTTGCTGGACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031912.3-1770s21c1
Sequence:GTACCGGGAATGGACCTGCAGGGTAAACCTCGAGGTTTACCCTGCAGGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-605s21c1
Sequence:GTACCGGTGTGGTTCTCGGTGGAATATGCTCGAGCATATTCCACCGAGAACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-1120s21c1
Sequence:GTACCGGATGAACCACAACAAGTTTGTCCTCGAGGACAAACTTGTTGTGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-1172s21c1
Sequence:GTACCGGCCATCAACCCTGTGTACAATGCTCGAGCATTGTACACAGGGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031912
SYT15 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XV
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-1179s1c1
Sequence:CCGGCCCTGTGTACAATGAGACCTTCTCGAGAAGGTCTCATTGTACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-603s1c1
Sequence:CCGGGCTGTGGTTCTCGGTGGAATACTCGAGTATTCCACCGAGAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-1084s1c1
Sequence:CCGGAGAGGCATTGTCAGTGTGTTTCTCGAGAAACACACTGACAATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-744s1c1
Sequence:CCGGCCAATCCAAGACCAAACGCAACTCGAGTTGCGTTTGGTCTTGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031912.3-901s1c1
Sequence:CCGGCCCTTGAAGAATGAGACCCTACTCGAGTAGGGTCTCATTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-745s21c1
Sequence:GTACCGGCAATCCAAGACCAAACGCAAACTCGAGTTTGCGTTTGGTCTTGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-1085s21c1
Sequence:GTACCGGGAGGCATTGTCAGTGTGTTTGCTCGAGCAAACACACTGACAATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-531s21c1
Sequence:GTACCGGCATCAACCCAGAGCTGTACAACTCGAGTTGTACAGCTCTGGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-831s21c1
Sequence:GTACCGGGGTGCTGAAGTTCTCCGTCTACTCGAGTAGACGGAGAACTTCAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-904s21c1
Sequence:GTACCGGTTGAAGAATGAGACCCTAGTGCTCGAGCACTAGGGTCTCATTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-803s21c1
Sequence:GTACCGGAGGTGTCCAGCAAGACCATCACTCGAGTGATGGTCTTGCTGGACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031912.3-1770s21c1
Sequence:GTACCGGGAATGGACCTGCAGGGTAAACCTCGAGGTTTACCCTGCAGGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-605s21c1
Sequence:GTACCGGTGTGGTTCTCGGTGGAATATGCTCGAGCATATTCCACCGAGAACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-1120s21c1
Sequence:GTACCGGATGAACCACAACAAGTTTGTCCTCGAGGACAAACTTGTTGTGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031912.3-1172s21c1
Sequence:GTACCGGCCATCAACCCTGTGTACAATGCTCGAGCATTGTACACAGGGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176931
SYT15 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XV
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-684s1c1
Sequence:CCGGCGTGTACCATGTAAACAAGAACTCGAGTTCTTGTTTACATGGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-141s1c1
Sequence:CCGGCATCTCTTACTTCAGCAGAAACTCGAGTTTCTGCTGAAGTAAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-200s1c1
Sequence:CCGGGCAGGCTACCAAGTGTACCATCTCGAGATGGTACACTTGGTAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-683s1c1
Sequence:CCGGCCGTGTACCATGTAAACAAGACTCGAGTCTTGTTTACATGGTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-960s1c1
Sequence:CCGGGAATCACAACAAATTCGTCAACTCGAGTTGACGAATTTGTTGTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176931.2-1330s21c1
Sequence:GTACCGGTGTTCCTGCCTCTGATTAAAGCTCGAGCTTTAATCAGAGGCAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176931.2-292s21c1
Sequence:GTACCGGAGGACAGGCTCTACCAGTATTCTCGAGAATACTGGTAGAGCCTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176931.2-330s21c1
Sequence:GTACCGGAGGCTACCAAGTGTACCATTTCTCGAGAAATGGTACACTTGGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176931.2-1530s21c1
Sequence:GTACCGGTGGTTTCCTGTCGTGAGTATTCTCGAGAATACTCACGACAGGAAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176931.2-806s21c1
Sequence:GTACCGGGTTCTCCGTGTACCATGTAAACTCGAGTTTACATGGTACACGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176931
SYT15 MISSION shRNA shRNA Plasmid DNA
synaptotagmin XV
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-684s1c1
Sequence:CCGGCGTGTACCATGTAAACAAGAACTCGAGTTCTTGTTTACATGGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-141s1c1
Sequence:CCGGCATCTCTTACTTCAGCAGAAACTCGAGTTTCTGCTGAAGTAAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-200s1c1
Sequence:CCGGGCAGGCTACCAAGTGTACCATCTCGAGATGGTACACTTGGTAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-683s1c1
Sequence:CCGGCCGTGTACCATGTAAACAAGACTCGAGTCTTGTTTACATGGTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-960s1c1
Sequence:CCGGGAATCACAACAAATTCGTCAACTCGAGTTGACGAATTTGTTGTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176931.2-1330s21c1
Sequence:GTACCGGTGTTCCTGCCTCTGATTAAAGCTCGAGCTTTAATCAGAGGCAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176931.2-292s21c1
Sequence:GTACCGGAGGACAGGCTCTACCAGTATTCTCGAGAATACTGGTAGAGCCTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176931.2-330s21c1
Sequence:GTACCGGAGGCTACCAAGTGTACCATTTCTCGAGAAATGGTACACTTGGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176931.2-1530s21c1
Sequence:GTACCGGTGGTTTCCTGTCGTGAGTATTCTCGAGAATACTCACGACAGGAAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176931.2-806s21c1
Sequence:GTACCGGGTTCTCCGTGTACCATGTAAACTCGAGTTTACATGGTACACGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176931
SYT15 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XV
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-684s1c1
Sequence:CCGGCGTGTACCATGTAAACAAGAACTCGAGTTCTTGTTTACATGGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-141s1c1
Sequence:CCGGCATCTCTTACTTCAGCAGAAACTCGAGTTTCTGCTGAAGTAAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-200s1c1
Sequence:CCGGGCAGGCTACCAAGTGTACCATCTCGAGATGGTACACTTGGTAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-683s1c1
Sequence:CCGGCCGTGTACCATGTAAACAAGACTCGAGTCTTGTTTACATGGTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176931.1-960s1c1
Sequence:CCGGGAATCACAACAAATTCGTCAACTCGAGTTGACGAATTTGTTGTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176931.2-1330s21c1
Sequence:GTACCGGTGTTCCTGCCTCTGATTAAAGCTCGAGCTTTAATCAGAGGCAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176931.2-292s21c1
Sequence:GTACCGGAGGACAGGCTCTACCAGTATTCTCGAGAATACTGGTAGAGCCTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176931.2-330s21c1
Sequence:GTACCGGAGGCTACCAAGTGTACCATTTCTCGAGAAATGGTACACTTGGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176931.2-1530s21c1
Sequence:GTACCGGTGGTTTCCTGTCGTGAGTATTCTCGAGAATACTCACGACAGGAAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176931.2-806s21c1
Sequence:GTACCGGGTTCTCCGTGTACCATGTAAACTCGAGTTTACATGGTACACGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks