EMAIL THIS PAGE TO A FRIEND

SYT16

synaptotagmin XVI

Synonyms: CHR14SYT SYT14L Strep14 syt14r yt14r
Gene ID:
Mouse(238266) synaptotagmin XVI
Rat(299142) synaptotagmin XVI
domestic guinea pig(100718126) synaptotagmin XVI
naked mole-rat(101715031) synaptotagmin XVI
Domestic Rabbit(100350441) synaptotagmin XVI
cow(540677) synaptotagmin XVI
sheep(101119140) synaptotagmin XVI
chicken(423516) synaptotagmin XVI
Horse(100051704) synaptotagmin XVI
domestic cat(101084115) synaptotagmin XVI
dog(490723) synaptotagmin XVI
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031914 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031914 Rosetta Predictions human pricing
XM_001077814 Rosetta Predictions rat pricing
XM_234300 Rosetta Predictions rat pricing
NM_172804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359039 predicted 357
2 SASI_Hs02_00359040 predicted 343
3 SASI_Hs01_00058303 predicted 908
4 SASI_Hs01_00058304 predicted 545
5 SASI_Hs01_00058306 predicted 1652
6 SASI_Hs01_00058307 predicted 1541
7 SASI_Hs02_00359041 predicted 246
8 SASI_Hs02_00359042 predicted 1953
9 SASI_Hs01_00058310 predicted 532
10 SASI_Hs02_00359043 predicted 1839
11 SASI_Hs01_00058301 predicted 278
12 SASI_Hs01_00058302 predicted 614
13 SASI_Hs01_00058305 predicted 1552
14 SASI_Hs01_00058308 predicted 250
15 SASI_Hs01_00058309 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358632 predicted 2567
2 SASI_Rn02_00358633 predicted 946
3 SASI_Rn02_00358634 predicted 2494
4 SASI_Rn02_00358635 predicted 1565
5 SASI_Rn02_00358636 predicted 1151
6 SASI_Rn02_00358637 predicted 1004
7 SASI_Rn02_00358638 predicted 2526
8 SASI_Rn02_00358639 predicted 747
9 SASI_Rn02_00358640 predicted 2468
10 SASI_Rn02_00358641 predicted 2367
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388376 predicted 762
2 SASI_Rn02_00388377 predicted 1684
3 SASI_Rn02_00388378 predicted 1561
4 SASI_Rn02_00388379 predicted 997
5 SASI_Rn02_00388380 predicted 747
6 SASI_Rn02_00388381 predicted 954
7 SASI_Rn02_00388382 predicted 1177
8 SASI_Rn02_00388383 predicted 1370
9 SASI_Rn02_00388384 predicted 777
10 SASI_Rn02_00388385 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344721 predicted 382
2 SASI_Mm02_00344722 predicted 570
3 SASI_Mm02_00344723 predicted 311
4 SASI_Mm02_00344724 predicted 538
5 SASI_Mm02_00344725 predicted 864
6 SASI_Mm01_00093336 predicted 1115
7 SASI_Mm02_00344726 predicted 410
8 SASI_Mm02_00344727 predicted 326
9 SASI_Mm02_00344728 predicted 334
10 SASI_Mm01_00093340 predicted 1820
11 SASI_Mm01_00093333 predicted 2351
12 SASI_Mm01_00093334 predicted 2551
13 SASI_Mm01_00093335 predicted 2740
14 SASI_Mm01_00093337 predicted 2622
15 SASI_Mm01_00093338 predicted 2687
16 SASI_Mm01_00093339 predicted 2653
17 SASI_Mm01_00093341 predicted 2376
18 SASI_Mm01_00093342 predicted 2243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172804
SYT16 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XVI
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172804.2-525s21c1
Sequence:GTACCGGGCAAGGGCAGGTCAATGATTTCTCGAGAAATCATTGACCTGCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172804.2-2046s21c1
Sequence:GTACCGGAGATTTCAAAGGAGCTATAAACTCGAGTTTATAGCTCCTTTGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172804.2-482s21c1
Sequence:GTACCGGGGTCTGCTTGTGAAGGTATTCCTCGAGGAATACCTTCACAAGCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172804.2-1349s21c1
Sequence:GTACCGGATGCCACAACAGGGCGATTATCTCGAGATAATCGCCCTGTTGTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172804.1-3236s1c1
Sequence:CCGGGCACCCAAAGAAGAAGAGGAACTCGAGTTCCTCTTCTTCTTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172804.1-2292s1c1
Sequence:CCGGCCTGTCTATAAAGAGACCTTTCTCGAGAAAGGTCTCTTTATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172804.1-2345s1c1
Sequence:CCGGCGTCACCTTGATGATTTCCATCTCGAGATGGAAATCATCAAGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172804.1-2375s1c1
Sequence:CCGGGCGCACTATGAAGCGTAAAGACTCGAGTCTTTACGCTTCATAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172804.1-2138s1c1
Sequence:CCGGAGGGCGATTATCTGTGGAAATCTCGAGATTTCCACAGATAATCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172804
SYT16 MISSION shRNA shRNA Plasmid DNA
synaptotagmin XVI
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172804.2-525s21c1
Sequence:GTACCGGGCAAGGGCAGGTCAATGATTTCTCGAGAAATCATTGACCTGCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172804.2-2046s21c1
Sequence:GTACCGGAGATTTCAAAGGAGCTATAAACTCGAGTTTATAGCTCCTTTGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172804.2-482s21c1
Sequence:GTACCGGGGTCTGCTTGTGAAGGTATTCCTCGAGGAATACCTTCACAAGCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172804.2-1349s21c1
Sequence:GTACCGGATGCCACAACAGGGCGATTATCTCGAGATAATCGCCCTGTTGTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172804.1-3236s1c1
Sequence:CCGGGCACCCAAAGAAGAAGAGGAACTCGAGTTCCTCTTCTTCTTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172804.1-2292s1c1
Sequence:CCGGCCTGTCTATAAAGAGACCTTTCTCGAGAAAGGTCTCTTTATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172804.1-2345s1c1
Sequence:CCGGCGTCACCTTGATGATTTCCATCTCGAGATGGAAATCATCAAGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172804.1-2375s1c1
Sequence:CCGGGCGCACTATGAAGCGTAAAGACTCGAGTCTTTACGCTTCATAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172804.1-2138s1c1
Sequence:CCGGAGGGCGATTATCTGTGGAAATCTCGAGATTTCCACAGATAATCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172804
SYT16 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XVI
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172804.2-525s21c1
Sequence:GTACCGGGCAAGGGCAGGTCAATGATTTCTCGAGAAATCATTGACCTGCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172804.2-2046s21c1
Sequence:GTACCGGAGATTTCAAAGGAGCTATAAACTCGAGTTTATAGCTCCTTTGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172804.2-482s21c1
Sequence:GTACCGGGGTCTGCTTGTGAAGGTATTCCTCGAGGAATACCTTCACAAGCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172804.2-1349s21c1
Sequence:GTACCGGATGCCACAACAGGGCGATTATCTCGAGATAATCGCCCTGTTGTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172804.1-3236s1c1
Sequence:CCGGGCACCCAAAGAAGAAGAGGAACTCGAGTTCCTCTTCTTCTTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172804.1-2292s1c1
Sequence:CCGGCCTGTCTATAAAGAGACCTTTCTCGAGAAAGGTCTCTTTATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172804.1-2345s1c1
Sequence:CCGGCGTCACCTTGATGATTTCCATCTCGAGATGGAAATCATCAAGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172804.1-2375s1c1
Sequence:CCGGGCGCACTATGAAGCGTAAAGACTCGAGTCTTTACGCTTCATAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172804.1-2138s1c1
Sequence:CCGGAGGGCGATTATCTGTGGAAATCTCGAGATTTCCACAGATAATCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031914
VALIDATED
SYT16 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XVI
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-1790s21c1
Sequence:CCGGTTTCCGAAACCTCGCTGTTAACTCGAGTTAACAGCGAGGTTTCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-1989s21c1
Sequence:CCGGAGGCGTACTATGAAGCGTAAACTCGAGTTTACGCTTCATAGTACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-1967s21c1
Sequence:CCGGGTTGATGATTTCCGTTTATAACTCGAGTTATAAACGGAAATCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031914.2-2499s21c1
Sequence:CCGGGTTACTATTTGCAACCATTTACTCGAGTAAATGGTTGCAAATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-1533s21c1
Sequence:CCGGGAGAGAATGATGGGAGAGAAACTCGAGTTTCTCTCCCATCATTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-577s21c1
Sequence:GTACCGGCCAGTGATGACCGCAAGTTACCTCGAGGTAACTTGCGGTCATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-355s21c1
Sequence:GTACCGGTAGATCAGGACTTAGATAATACTCGAGTATTATCTAAGTCCTGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-675s21c1
Sequence:GTACCGGAGCCAGCTCCCTGGTACTTTACTCGAGTAAAGTACCAGGGAGCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-449s21c1
Sequence:GTACCGGGTTTCTTGAAGTGGATCATTTCTCGAGAAATGATCCACTTCAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-379s21c1
Sequence:GTACCGGAGATTCAGGAAACGTACTTTGCTCGAGCAAAGTACGTTTCCTGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_031914.x-652s1c1
Sequence:CCGGCAGACAGGATTGGAGCAGAAACTCGAGTTTCTGCTCCAATCCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031914.x-151s1c1
Sequence:CCGGGACAAACTAGATCAGGACTTACTCGAGTAAGTCCTGATCTAGTTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_031914.x-1709s1c1
Sequence:CCGGCGTTGATGATTTCCGTTTATACTCGAGTATAAACGGAAATCATCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031914.x-1816s1c1
Sequence:CCGGGAGGAGATGAAGGAAACCAAACTCGAGTTTGGTTTCCTTCATCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031914.x-1276s1c1
Sequence:CCGGGAGAGAATGATGGGAGAGAAACTCGAGTTTCTCTCCCATCATTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031914
VALIDATED
SYT16 MISSION shRNA shRNA Plasmid DNA
synaptotagmin XVI
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-1790s21c1
Sequence:CCGGTTTCCGAAACCTCGCTGTTAACTCGAGTTAACAGCGAGGTTTCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-1989s21c1
Sequence:CCGGAGGCGTACTATGAAGCGTAAACTCGAGTTTACGCTTCATAGTACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-1967s21c1
Sequence:CCGGGTTGATGATTTCCGTTTATAACTCGAGTTATAAACGGAAATCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031914.2-2499s21c1
Sequence:CCGGGTTACTATTTGCAACCATTTACTCGAGTAAATGGTTGCAAATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-1533s21c1
Sequence:CCGGGAGAGAATGATGGGAGAGAAACTCGAGTTTCTCTCCCATCATTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-577s21c1
Sequence:GTACCGGCCAGTGATGACCGCAAGTTACCTCGAGGTAACTTGCGGTCATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-355s21c1
Sequence:GTACCGGTAGATCAGGACTTAGATAATACTCGAGTATTATCTAAGTCCTGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-675s21c1
Sequence:GTACCGGAGCCAGCTCCCTGGTACTTTACTCGAGTAAAGTACCAGGGAGCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-449s21c1
Sequence:GTACCGGGTTTCTTGAAGTGGATCATTTCTCGAGAAATGATCCACTTCAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-379s21c1
Sequence:GTACCGGAGATTCAGGAAACGTACTTTGCTCGAGCAAAGTACGTTTCCTGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_031914.x-652s1c1
Sequence:CCGGCAGACAGGATTGGAGCAGAAACTCGAGTTTCTGCTCCAATCCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031914.x-151s1c1
Sequence:CCGGGACAAACTAGATCAGGACTTACTCGAGTAAGTCCTGATCTAGTTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_031914.x-1709s1c1
Sequence:CCGGCGTTGATGATTTCCGTTTATACTCGAGTATAAACGGAAATCATCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031914.x-1816s1c1
Sequence:CCGGGAGGAGATGAAGGAAACCAAACTCGAGTTTGGTTTCCTTCATCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031914.x-1276s1c1
Sequence:CCGGGAGAGAATGATGGGAGAGAAACTCGAGTTTCTCTCCCATCATTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031914
VALIDATED
SYT16 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XVI
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-1790s21c1
Sequence:CCGGTTTCCGAAACCTCGCTGTTAACTCGAGTTAACAGCGAGGTTTCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-1989s21c1
Sequence:CCGGAGGCGTACTATGAAGCGTAAACTCGAGTTTACGCTTCATAGTACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-1967s21c1
Sequence:CCGGGTTGATGATTTCCGTTTATAACTCGAGTTATAAACGGAAATCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031914.2-2499s21c1
Sequence:CCGGGTTACTATTTGCAACCATTTACTCGAGTAAATGGTTGCAAATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-1533s21c1
Sequence:CCGGGAGAGAATGATGGGAGAGAAACTCGAGTTTCTCTCCCATCATTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-577s21c1
Sequence:GTACCGGCCAGTGATGACCGCAAGTTACCTCGAGGTAACTTGCGGTCATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-355s21c1
Sequence:GTACCGGTAGATCAGGACTTAGATAATACTCGAGTATTATCTAAGTCCTGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-675s21c1
Sequence:GTACCGGAGCCAGCTCCCTGGTACTTTACTCGAGTAAAGTACCAGGGAGCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-449s21c1
Sequence:GTACCGGGTTTCTTGAAGTGGATCATTTCTCGAGAAATGATCCACTTCAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031914.2-379s21c1
Sequence:GTACCGGAGATTCAGGAAACGTACTTTGCTCGAGCAAAGTACGTTTCCTGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_031914.x-652s1c1
Sequence:CCGGCAGACAGGATTGGAGCAGAAACTCGAGTTTCTGCTCCAATCCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031914.x-151s1c1
Sequence:CCGGGACAAACTAGATCAGGACTTACTCGAGTAAGTCCTGATCTAGTTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_031914.x-1709s1c1
Sequence:CCGGCGTTGATGATTTCCGTTTATACTCGAGTATAAACGGAAATCATCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031914.x-1816s1c1
Sequence:CCGGGAGGAGATGAAGGAAACCAAACTCGAGTTTGGTTTCCTTCATCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031914.x-1276s1c1
Sequence:CCGGGAGAGAATGATGGGAGAGAAACTCGAGTTTCTCTCCCATCATTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks