EMAIL THIS PAGE TO A FRIEND

SYT17

synaptotagmin XVII

UniProtKB ID: Q9BSW7, O43330, Q9NZ18
Gene ID:
Mouse(110058) synaptotagmin XVII
Rat(192189) synaptotagmin XVII
chicken(416608) synaptotagmin XVII
Horse(100052854) synaptotagmin XVII
domestic cat(101086194) synaptotagmin XVII
dog(479829) synaptotagmin XVII
cow(532273) synaptotagmin XVII
sheep(101115845) synaptotagmin XVII
naked mole-rat(101699027) synaptotagmin XVII
domestic guinea pig(100736156) synaptotagmin XVII
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138649 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138649 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138649 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016524 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006061 MISSION® esiRNA esiRNA targeting human SYT7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016524 Rosetta Predictions human pricing
NM_138849 Rosetta Predictions rat pricing
NM_138649 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170015 predicted 1076
2 SASI_Hs01_00170016 predicted 1085
3 SASI_Hs01_00170017 predicted 1533
4 SASI_Hs01_00170018 predicted 641
5 SASI_Hs02_00349624 predicted 678
6 SASI_Hs01_00170019 predicted 1147
7 SASI_Hs01_00170020 predicted 1360
8 SASI_Hs01_00170021 predicted 677
9 SASI_Hs01_00170022 predicted 1192
10 SASI_Hs01_00170023 predicted 1340
11 SASI_Hs01_00170024 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058228 predicted 846
2 SASI_Rn02_00268238 predicted 530
3 SASI_Rn01_00058230 predicted 1230
4 SASI_Rn01_00058231 predicted 440
5 SASI_Rn01_00058232 predicted 967
6 SASI_Rn01_00058233 predicted 579
7 SASI_Rn02_00268239 predicted 850
8 SASI_Rn01_00058234 predicted 1153
9 SASI_Rn02_00268240 predicted 576
10 SASI_Rn01_00058236 predicted 457
11 SASI_Rn01_00058229 predicted 1311
12 SASI_Rn01_00058235 predicted 281
13 SASI_Rn01_00058237 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129517 predicted 945
2 SASI_Mm01_00129518 predicted 760
3 SASI_Mm01_00129519 predicted 1046
4 SASI_Mm01_00129520 predicted 208
5 SASI_Mm01_00129521 predicted 1070
6 SASI_Mm01_00129522 predicted 1188
7 SASI_Mm01_00129523 predicted 619
8 SASI_Mm01_00129524 predicted 679
9 SASI_Mm01_00129525 predicted 356
10 SASI_Mm02_00339700 predicted 1198
11 SASI_Mm01_00129526 predicted 1011
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138649
VALIDATED
SYT17 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XVII
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-642s1c1
Sequence:CCGGCGATGACTACTTCCGGAAGTTCTCGAGAACTTCCGGAAGTAGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-1322s1c1
Sequence:CCGGCATCATTCTTACGAGGCACAACTCGAGTTGTGCCTCGTAAGAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-754s1c1
Sequence:CCGGCTGCACTTCAGCACACAGTATCTCGAGATACTGTGTGCTGAAGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-643s1c1
Sequence:CCGGGATGACTACTTCCGGAAGTTTCTCGAGAAACTTCCGGAAGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-685s1c1
Sequence:CCGGGACTCCAATCTTGATGACGTACTCGAGTACGTCATCAAGATTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138649.1-644s21c1
Sequence:CCGGATGACTACTTCCGGAAGTTTGCTCGAGCAAACTTCCGGAAGTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138649.1-1324s21c1
Sequence:CCGGTCATTCTTACGAGGCACAATTCTCGAGAATTGTGCCTCGTAAGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138649.1-1163s21c1
Sequence:CCGGAGCTGCTGCTTTCTCTAAATTCTCGAGAATTTAGAGAAAGCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138649.1-499s21c1
Sequence:CCGGTACAGCCTGACTCGGAGAATCCTCGAGGATTCTCCGAGTCAGGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138649.1-1202s21c1
Sequence:CCGGGACTGAACGTGGACATCATTCCTCGAGGAATGATGTCCACGTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138649
VALIDATED
SYT17 MISSION shRNA shRNA Plasmid DNA
synaptotagmin XVII
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-642s1c1
Sequence:CCGGCGATGACTACTTCCGGAAGTTCTCGAGAACTTCCGGAAGTAGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-1322s1c1
Sequence:CCGGCATCATTCTTACGAGGCACAACTCGAGTTGTGCCTCGTAAGAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-754s1c1
Sequence:CCGGCTGCACTTCAGCACACAGTATCTCGAGATACTGTGTGCTGAAGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-643s1c1
Sequence:CCGGGATGACTACTTCCGGAAGTTTCTCGAGAAACTTCCGGAAGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-685s1c1
Sequence:CCGGGACTCCAATCTTGATGACGTACTCGAGTACGTCATCAAGATTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138649.1-644s21c1
Sequence:CCGGATGACTACTTCCGGAAGTTTGCTCGAGCAAACTTCCGGAAGTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138649.1-1324s21c1
Sequence:CCGGTCATTCTTACGAGGCACAATTCTCGAGAATTGTGCCTCGTAAGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138649.1-1163s21c1
Sequence:CCGGAGCTGCTGCTTTCTCTAAATTCTCGAGAATTTAGAGAAAGCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138649.1-499s21c1
Sequence:CCGGTACAGCCTGACTCGGAGAATCCTCGAGGATTCTCCGAGTCAGGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138649.1-1202s21c1
Sequence:CCGGGACTGAACGTGGACATCATTCCTCGAGGAATGATGTCCACGTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138649
VALIDATED
SYT17 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XVII
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-642s1c1
Sequence:CCGGCGATGACTACTTCCGGAAGTTCTCGAGAACTTCCGGAAGTAGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-1322s1c1
Sequence:CCGGCATCATTCTTACGAGGCACAACTCGAGTTGTGCCTCGTAAGAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-754s1c1
Sequence:CCGGCTGCACTTCAGCACACAGTATCTCGAGATACTGTGTGCTGAAGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-643s1c1
Sequence:CCGGGATGACTACTTCCGGAAGTTTCTCGAGAAACTTCCGGAAGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138649.1-685s1c1
Sequence:CCGGGACTCCAATCTTGATGACGTACTCGAGTACGTCATCAAGATTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138649.1-644s21c1
Sequence:CCGGATGACTACTTCCGGAAGTTTGCTCGAGCAAACTTCCGGAAGTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138649.1-1324s21c1
Sequence:CCGGTCATTCTTACGAGGCACAATTCTCGAGAATTGTGCCTCGTAAGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138649.1-1163s21c1
Sequence:CCGGAGCTGCTGCTTTCTCTAAATTCTCGAGAATTTAGAGAAAGCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138649.1-499s21c1
Sequence:CCGGTACAGCCTGACTCGGAGAATCCTCGAGGATTCTCCGAGTCAGGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138649.1-1202s21c1
Sequence:CCGGGACTGAACGTGGACATCATTCCTCGAGGAATGATGTCCACGTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016524
SYT17 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin XVII
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016524.x-304s1c1
Sequence:CCGGCCAAGTCTACATACAGCCTGACTCGAGTCAGGCTGTATGTAGACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016524.x-1101s1c1
Sequence:CCGGCTGGTGCATGGACTCAAACTTCTCGAGAAGTTTGAGTCCATGCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016524.x-716s1c1
Sequence:CCGGGCCAGACCAGAAGAACTCAAACTCGAGTTTGAGTTCTTCTGGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016524.x-361s1c1
Sequence:CCGGGCTCTCCACTCATCGATATTACTCGAGTAATATCGATGAGTGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016524.x-1446s1c1
Sequence:CCGGAGGCAGCTTTCATTTGTTTAACTCGAGTTAAACAAATGAAAGCTGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-709s21c1
Sequence:GTACCGGCATCGAGTTTGGCGTTCTCAGCTCGAGCTGAGAACGCCAAACTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-1422s21c1
Sequence:GTACCGGAGCTGGTGCATGGACTCAAACCTCGAGGTTTGAGTCCATGCACCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-1040s21c1
Sequence:GTACCGGCCAGACCAGAAGAACTCAAAGCTCGAGCTTTGAGTTCTTCTGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-647s21c1
Sequence:GTACCGGACGCGGAGGATTTCGAGTCTTCTCGAGAAGACTCGAAATCCTCCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-683s21c1
Sequence:GTACCGGAGCTCTCCACTCATCGATATTCTCGAGAATATCGATGAGTGGAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-620s21c1
Sequence:GTACCGGGACACATCCAAGTCTACATACCTCGAGGTATGTAGACTTGGATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-757s21c1
Sequence:GTACCGGGGTGCTCAGACGGACCTATAACTCGAGTTATAGGTCCGTCTGAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016524
SYT17 MISSION shRNA shRNA Plasmid DNA
synaptotagmin XVII
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016524.x-304s1c1
Sequence:CCGGCCAAGTCTACATACAGCCTGACTCGAGTCAGGCTGTATGTAGACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016524.x-1101s1c1
Sequence:CCGGCTGGTGCATGGACTCAAACTTCTCGAGAAGTTTGAGTCCATGCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016524.x-716s1c1
Sequence:CCGGGCCAGACCAGAAGAACTCAAACTCGAGTTTGAGTTCTTCTGGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016524.x-361s1c1
Sequence:CCGGGCTCTCCACTCATCGATATTACTCGAGTAATATCGATGAGTGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016524.x-1446s1c1
Sequence:CCGGAGGCAGCTTTCATTTGTTTAACTCGAGTTAAACAAATGAAAGCTGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-709s21c1
Sequence:GTACCGGCATCGAGTTTGGCGTTCTCAGCTCGAGCTGAGAACGCCAAACTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-1422s21c1
Sequence:GTACCGGAGCTGGTGCATGGACTCAAACCTCGAGGTTTGAGTCCATGCACCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-1040s21c1
Sequence:GTACCGGCCAGACCAGAAGAACTCAAAGCTCGAGCTTTGAGTTCTTCTGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-647s21c1
Sequence:GTACCGGACGCGGAGGATTTCGAGTCTTCTCGAGAAGACTCGAAATCCTCCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-683s21c1
Sequence:GTACCGGAGCTCTCCACTCATCGATATTCTCGAGAATATCGATGAGTGGAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-620s21c1
Sequence:GTACCGGGACACATCCAAGTCTACATACCTCGAGGTATGTAGACTTGGATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-757s21c1
Sequence:GTACCGGGGTGCTCAGACGGACCTATAACTCGAGTTATAGGTCCGTCTGAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016524
SYT17 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin XVII
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016524.x-304s1c1
Sequence:CCGGCCAAGTCTACATACAGCCTGACTCGAGTCAGGCTGTATGTAGACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016524.x-1101s1c1
Sequence:CCGGCTGGTGCATGGACTCAAACTTCTCGAGAAGTTTGAGTCCATGCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016524.x-716s1c1
Sequence:CCGGGCCAGACCAGAAGAACTCAAACTCGAGTTTGAGTTCTTCTGGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016524.x-361s1c1
Sequence:CCGGGCTCTCCACTCATCGATATTACTCGAGTAATATCGATGAGTGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016524.x-1446s1c1
Sequence:CCGGAGGCAGCTTTCATTTGTTTAACTCGAGTTAAACAAATGAAAGCTGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-709s21c1
Sequence:GTACCGGCATCGAGTTTGGCGTTCTCAGCTCGAGCTGAGAACGCCAAACTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-1422s21c1
Sequence:GTACCGGAGCTGGTGCATGGACTCAAACCTCGAGGTTTGAGTCCATGCACCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-1040s21c1
Sequence:GTACCGGCCAGACCAGAAGAACTCAAAGCTCGAGCTTTGAGTTCTTCTGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-647s21c1
Sequence:GTACCGGACGCGGAGGATTTCGAGTCTTCTCGAGAAGACTCGAAATCCTCCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-683s21c1
Sequence:GTACCGGAGCTCTCCACTCATCGATATTCTCGAGAATATCGATGAGTGGAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-620s21c1
Sequence:GTACCGGGACACATCCAAGTCTACATACCTCGAGGTATGTAGACTTGGATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016524.2-757s21c1
Sequence:GTACCGGGGTGCTCAGACGGACCTATAACTCGAGTTATAGGTCCGTCTGAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks