EMAIL THIS PAGE TO A FRIEND

SYT1

synaptotagmin I

Synonyms: P65 SVP65 SYT
UniProtKB ID: P21579, Q6AI31
Gene ID:
Human(6857) Summary: The synaptotagmins are integral membrane proteins of synaptic vesicles thought to serve as Ca(2+) sensors in the process of vesicular trafficking and exocytosis. Calcium binding to synaptotagmin-1 participates in triggering neurotransmitter release at the synapse (Fernandez-Chacon et al., 2001 [PubMed 11242035]
Mouse(20979) synaptotagmin I
Rat(25716) synaptotagmin I
cow(281511) synaptotagmin I
sheep(101102712) synaptotagmin I
naked mole-rat(101701697) synaptotagmin I
Domestic Rabbit(100350072) synaptotagmin I
fruit fly(33473) Synaptotagmin 1
dog(482579) synaptotagmin I
chicken(396083) synaptotagmin I
193 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503782 Anti-phospho-Synaptotagmin (pSer309) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4503783 Anti-phospho-Synaptotagmin (pThr202) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301225 Anti-phospho-Synaptotagmin (pThr202) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
S3821 Anti-phospho-Synaptotagmin (Ser309) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
dot blot, western blot pricing
SAB4300168 Anti-phospho-SYT1 (pSer309) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence pricing
S2177 Anti-Synaptotagmin antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat
microarray, western blot pricing
SAB4502907 Anti-Synaptotagmin antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4502908 Anti-Synaptotagmin antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4300542 Anti-SYT1 (Ab-309) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence pricing
SAB2501176 Anti-SYT1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
HPA008394 Anti-SYT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA064788 Anti-SYT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2107391 Anti-SYT1 antibody produced in rabbit affinity isolated antibody human, guinea pig, mouse, rabbit, horse
ELISA, western blot pricing
SAB4300543 Anti-SYT1/SYT2 (Ab-202/199) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, western blot pricing
WH0006857M5 Monoclonal Anti-SYT1 antibody produced in mouse clone 1A6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404433 Monoclonal Anti-SYT1 antibody produced in mouse clone 3A5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300361 Monoclonal Anti-SYT1 antibody produced in mouse clone 8G11B10, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005639 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005639 Rosetta Predictions human pricing
NM_001033680 Rosetta Predictions rat pricing
NM_009306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023976 predicted 1361
2 SASI_Hs01_00023977 predicted 1306
3 SASI_Hs01_00023978 predicted 1327
4 SASI_Hs01_00023980 predicted 836
5 SASI_Hs01_00023981 predicted 556
6 SASI_Hs01_00023982 predicted 958
7 SASI_Hs01_00023984 predicted 1086
8 SASI_Hs01_00023985 predicted 984
9 SASI_Hs02_00339976 predicted 1220
10 SASI_Hs02_00339977 predicted 869
11 SASI_Hs01_00023979 predicted 1056
12 SASI_Hs01_00023983 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038667 predicted 915
2 SASI_Rn01_00038669 predicted 908
3 SASI_Rn01_00038668 predicted 946
4 SASI_Rn02_00203689 predicted 1645
5 SASI_Rn01_00038672 predicted 1236
6 SASI_Rn01_00038673 predicted 1324
7 SASI_Rn02_00203690 predicted 1118
8 SASI_Rn01_00038674 predicted 1072
9 SASI_Rn01_00038675 predicted 1370
10 SASI_Rn01_00038676 predicted 1075
11 SASI_Rn01_00038670 predicted 1779
12 SASI_Rn01_00038671 predicted 1642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057864 predicted 829
2 SASI_Mm01_00057865 predicted 1526
3 SASI_Mm01_00057866 predicted 1140
4 SASI_Mm01_00057867 predicted 872
5 SASI_Mm01_00057868 predicted 1527
6 SASI_Mm01_00057869 predicted 959
7 SASI_Mm01_00057870 predicted 1122
8 SASI_Mm01_00057871 predicted 938
9 SASI_Mm01_00057872 predicted 1262
10 SASI_Mm01_00057873 predicted 936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005639
VALIDATED
SYT1 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005639.2-1187s21c1
Sequence:CCGGCATCTGATCCTTACGTGAAAGCTCGAGCTTTCACGTAAGGATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005639.2-2184s21c1
Sequence:CCGGTTGTATCACACTGTTGTATATCTCGAGATATACAACAGTGTGATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005639.2-2326s21c1
Sequence:CCGGGATATAGGAGAGCTGATAATACTCGAGTATTATCAGCTCTCCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005639.2-1942s21c1
Sequence:CCGGTTTCTGCATTTGCCCATATAGCTCGAGCTATATGGGCAAATGCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005639.1-837s1c1
Sequence:CCGGGCAAGAGAAATTGGGTGATATCTCGAGATATCACCCAATTTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005639.1-585s1c1
Sequence:CCGGGCTACCTGATAAGAAGAAGAACTCGAGTTCTTCTTCTTATCAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005639.1-640s1c1
Sequence:CCGGCCTGTCTTCAATGAGCAATTTCTCGAGAAATTGCTCATTGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005639.1-82s1c1
Sequence:CCGGGCGACTGTTCTGCCAAGCAATCTCGAGATTGCTTGGCAGAACAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005639.1-1151s1c1
Sequence:CCGGGCAAAGTCTTTGTGGGCTACACTCGAGTGTAGCCCACAAAGACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005639
VALIDATED
SYT1 MISSION shRNA shRNA Plasmid DNA
synaptotagmin I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005639.2-1187s21c1
Sequence:CCGGCATCTGATCCTTACGTGAAAGCTCGAGCTTTCACGTAAGGATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005639.2-2184s21c1
Sequence:CCGGTTGTATCACACTGTTGTATATCTCGAGATATACAACAGTGTGATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005639.2-2326s21c1
Sequence:CCGGGATATAGGAGAGCTGATAATACTCGAGTATTATCAGCTCTCCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005639.2-1942s21c1
Sequence:CCGGTTTCTGCATTTGCCCATATAGCTCGAGCTATATGGGCAAATGCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005639.1-837s1c1
Sequence:CCGGGCAAGAGAAATTGGGTGATATCTCGAGATATCACCCAATTTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005639.1-585s1c1
Sequence:CCGGGCTACCTGATAAGAAGAAGAACTCGAGTTCTTCTTCTTATCAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005639.1-640s1c1
Sequence:CCGGCCTGTCTTCAATGAGCAATTTCTCGAGAAATTGCTCATTGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005639.1-82s1c1
Sequence:CCGGGCGACTGTTCTGCCAAGCAATCTCGAGATTGCTTGGCAGAACAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005639.1-1151s1c1
Sequence:CCGGGCAAAGTCTTTGTGGGCTACACTCGAGTGTAGCCCACAAAGACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005639
VALIDATED
SYT1 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005639.2-1187s21c1
Sequence:CCGGCATCTGATCCTTACGTGAAAGCTCGAGCTTTCACGTAAGGATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005639.2-2184s21c1
Sequence:CCGGTTGTATCACACTGTTGTATATCTCGAGATATACAACAGTGTGATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005639.2-2326s21c1
Sequence:CCGGGATATAGGAGAGCTGATAATACTCGAGTATTATCAGCTCTCCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005639.2-1942s21c1
Sequence:CCGGTTTCTGCATTTGCCCATATAGCTCGAGCTATATGGGCAAATGCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005639.1-837s1c1
Sequence:CCGGGCAAGAGAAATTGGGTGATATCTCGAGATATCACCCAATTTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005639.1-585s1c1
Sequence:CCGGGCTACCTGATAAGAAGAAGAACTCGAGTTCTTCTTCTTATCAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005639.1-640s1c1
Sequence:CCGGCCTGTCTTCAATGAGCAATTTCTCGAGAAATTGCTCATTGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005639.1-82s1c1
Sequence:CCGGGCGACTGTTCTGCCAAGCAATCTCGAGATTGCTTGGCAGAACAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005639.1-1151s1c1
Sequence:CCGGGCAAAGTCTTTGTGGGCTACACTCGAGTGTAGCCCACAAAGACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009306
SYT1 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin I
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009306.2-513s21c1
Sequence:GTACCGGGGGAGGGAAGAACGCCATTAACTCGAGTTAATGGCGTTCTTCCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009306.2-565s21c1
Sequence:GTACCGGATGAAGGATCAGGCCCTTAAGCTCGAGCTTAAGGGCCTGATCCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009306.2-1588s21c1
Sequence:GTACCGGCCATGCATTCCTGATACAATCCTCGAGGATTGTATCAGGAATGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009306.2-1263s21c1
Sequence:GTACCGGTGAAGTTCCGTTCGAGCAAATCTCGAGATTTGCTCGAACGGAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009306.2-755s21c1
Sequence:GTACCGGCATCTGATCCATACGTCAAAGCTCGAGCTTTGACGTATGGATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009306.2-1557s1c1
Sequence:CCGGCCTCAGTAATATGGGTCCTTTCTCGAGAAAGGACCCATATTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009306.2-660s1c1
Sequence:CCGGGCTTCAATATTCACTGGACTACTCGAGTAGTCCAGTGAATATTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009306.2-839s1c1
Sequence:CCGGCAGTCTTCAATGAACAGTTTACTCGAGTAAACTGTTCATTGAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009306.2-403s1c1
Sequence:CCGGGCCTTAATTGCCATAGCCATACTCGAGTATGGCTATGGCAATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009306.2-1276s1c1
Sequence:CCGGGAGCAAATCCAGAAAGTGCAACTCGAGTTGCACTTTCTGGATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009306
SYT1 MISSION shRNA shRNA Plasmid DNA
synaptotagmin I
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009306.2-513s21c1
Sequence:GTACCGGGGGAGGGAAGAACGCCATTAACTCGAGTTAATGGCGTTCTTCCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009306.2-565s21c1
Sequence:GTACCGGATGAAGGATCAGGCCCTTAAGCTCGAGCTTAAGGGCCTGATCCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009306.2-1588s21c1
Sequence:GTACCGGCCATGCATTCCTGATACAATCCTCGAGGATTGTATCAGGAATGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009306.2-1263s21c1
Sequence:GTACCGGTGAAGTTCCGTTCGAGCAAATCTCGAGATTTGCTCGAACGGAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009306.2-755s21c1
Sequence:GTACCGGCATCTGATCCATACGTCAAAGCTCGAGCTTTGACGTATGGATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009306.2-1557s1c1
Sequence:CCGGCCTCAGTAATATGGGTCCTTTCTCGAGAAAGGACCCATATTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009306.2-660s1c1
Sequence:CCGGGCTTCAATATTCACTGGACTACTCGAGTAGTCCAGTGAATATTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009306.2-839s1c1
Sequence:CCGGCAGTCTTCAATGAACAGTTTACTCGAGTAAACTGTTCATTGAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009306.2-403s1c1
Sequence:CCGGGCCTTAATTGCCATAGCCATACTCGAGTATGGCTATGGCAATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009306.2-1276s1c1
Sequence:CCGGGAGCAAATCCAGAAAGTGCAACTCGAGTTGCACTTTCTGGATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009306
SYT1 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin I
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009306.2-513s21c1
Sequence:GTACCGGGGGAGGGAAGAACGCCATTAACTCGAGTTAATGGCGTTCTTCCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009306.2-565s21c1
Sequence:GTACCGGATGAAGGATCAGGCCCTTAAGCTCGAGCTTAAGGGCCTGATCCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009306.2-1588s21c1
Sequence:GTACCGGCCATGCATTCCTGATACAATCCTCGAGGATTGTATCAGGAATGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009306.2-1263s21c1
Sequence:GTACCGGTGAAGTTCCGTTCGAGCAAATCTCGAGATTTGCTCGAACGGAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009306.2-755s21c1
Sequence:GTACCGGCATCTGATCCATACGTCAAAGCTCGAGCTTTGACGTATGGATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009306.2-1557s1c1
Sequence:CCGGCCTCAGTAATATGGGTCCTTTCTCGAGAAAGGACCCATATTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009306.2-660s1c1
Sequence:CCGGGCTTCAATATTCACTGGACTACTCGAGTAGTCCAGTGAATATTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009306.2-839s1c1
Sequence:CCGGCAGTCTTCAATGAACAGTTTACTCGAGTAAACTGTTCATTGAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009306.2-403s1c1
Sequence:CCGGGCCTTAATTGCCATAGCCATACTCGAGTATGGCTATGGCAATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009306.2-1276s1c1
Sequence:CCGGGAGCAAATCCAGAAAGTGCAACTCGAGTTGCACTTTCTGGATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks