EMAIL THIS PAGE TO A FRIEND

SYT3

synaptotagmin III

Synonyms: SytIII
UniProtKB ID: Q9BQG1, Q8N5Z1, Q8N640
Gene ID:
Mouse(20981) synaptotagmin III
Rat(25731) synaptotagmin III
domestic cat(101087116) synaptotagmin III
Horse(100062910) synaptotagmin III
dog(484360) synaptotagmin III
cow(538513) synaptotagmin III
sheep(101111311) synaptotagmin III
naked mole-rat(101721697) synaptotagmin III
domestic guinea pig(100718091) synaptotagmin III
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1102713 Anti-SYT3 (556-568) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2102353 Anti-SYT3 antibody produced in rabbit affinity isolated antibody canine, guinea pig, bovine, human, mouse, rat, horse
western blot pricing
SAB4300810 Anti-SYT3 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB5200843 Monoclonal Anti-Synaptotagmin-3 - Alkaline Phosphatase antibody produced in mouse clone S278-19, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200844 Monoclonal Anti-Synaptotagmin-3 - Apc antibody produced in mouse clone S278-19, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5200835 Monoclonal Anti-Synaptotagmin-3 - Atto 390 antibody produced in mouse clone S278-19, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200836 Monoclonal Anti-Synaptotagmin-3 - Atto 488 antibody produced in mouse clone S278-19, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5200837 Monoclonal Anti-Synaptotagmin-3 - Atto 565 antibody produced in mouse clone S278-19, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5200838 Monoclonal Anti-Synaptotagmin-3 - Atto 594 antibody produced in mouse clone S278-19, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200839 Monoclonal Anti-Synaptotagmin-3 - Atto 633 antibody produced in mouse clone S278-19, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200840 Monoclonal Anti-Synaptotagmin-3 - Atto 655 antibody produced in mouse clone S278-19, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200841 Monoclonal Anti-Synaptotagmin-3 - Atto 680 antibody produced in mouse clone S278-19, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200842 Monoclonal Anti-Synaptotagmin-3 - Atto 700 antibody produced in mouse clone S278-19, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200845 Monoclonal Anti-Synaptotagmin-3 - Biotin antibody produced in mouse clone S278-19, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200846 Monoclonal Anti-Synaptotagmin-3 - Fitc antibody produced in mouse clone S278-19, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200847 Monoclonal Anti-Synaptotagmin-3 - Hrp antibody produced in mouse clone S278-19, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200848 Monoclonal Anti-Synaptotagmin-3 - Pe/Atto 594 antibody produced in mouse clone S278-19, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200849 Monoclonal Anti-Synaptotagmin-3 - Percp antibody produced in mouse clone S278-19, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200850 Monoclonal Anti-Synaptotagmin-3 - Rpe antibody produced in mouse clone S278-19, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200851 Monoclonal Anti-Synaptotagmin-3 - Streptavidin antibody produced in mouse clone S278-19, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5200834 Monoclonal Anti-Synaptotagmin-3 antibody produced in mouse clone S278-19, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032298 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032298 Rosetta Predictions human pricing
NM_019122 Rosetta Predictions rat pricing
NM_001114116 Rosetta Predictions mouse pricing
NM_016663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089780 predicted 1929
2 SASI_Hs01_00089781 predicted 2010
3 SASI_Hs01_00089782 predicted 664
4 SASI_Hs02_00359635 predicted 2363
5 SASI_Hs01_00089783 predicted 2473
6 SASI_Hs01_00089784 predicted 1415
7 SASI_Hs01_00089785 predicted 794
8 SASI_Hs01_00089786 predicted 1429
9 SASI_Hs01_00089787 predicted 2465
10 SASI_Hs01_00089788 predicted 2345
11 SASI_Hs01_00089789 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097421 predicted 1826
2 SASI_Rn01_00097422 predicted 1473
3 SASI_Rn01_00097424 predicted 1838
4 SASI_Rn01_00097425 predicted 742
5 SASI_Rn01_00097426 predicted 921
6 SASI_Rn01_00097427 predicted 1265
7 SASI_Rn02_00261857 predicted 1834
8 SASI_Rn01_00097428 predicted 1458
9 SASI_Rn01_00097429 predicted 905
10 SASI_Rn01_00097430 predicted 1078
11 SASI_Rn01_00097423 predicted 1844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308399 predicted 1572
2 SASI_Mm02_00308400 predicted 683
3 SASI_Mm02_00308401 predicted 843
4 SASI_Mm02_00308402 predicted 1923
5 SASI_Mm02_00308403 predicted 1937
6 SASI_Mm02_00308404 predicted 1488
7 SASI_Mm02_00308405 predicted 2167
8 SASI_Mm02_00308406 predicted 1560
9 SASI_Mm02_00308407 predicted 2034
10 SASI_Mm02_00308408 predicted 1938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177578 predicted 1602
2 SASI_Mm01_00177580 predicted 714
3 SASI_Mm01_00177581 predicted 876
4 SASI_Mm01_00177582 predicted 1949
5 SASI_Mm02_00323274 predicted 1967
6 SASI_Mm01_00177583 predicted 1516
7 SASI_Mm02_00323275 predicted 2199
8 SASI_Mm01_00177585 predicted 1583
9 SASI_Mm02_00323276 predicted 2067
10 SASI_Mm02_00323277 predicted 1963
11 SASI_Mm01_00177579 predicted 268
12 SASI_Mm01_00177584 predicted 360
13 SASI_Mm01_00177586 predicted 1144
14 SASI_Mm01_00177587 predicted 1312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016663
SYT3 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin III
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-1246s1c1
Sequence:CCGGCCCATCTTCAACGAGACGTTTCTCGAGAAACGTCTCGTTGAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-244s1c1
Sequence:CCGGCGAGATGCTGATACCAATGATCTCGAGATCATTGGTATCAGCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-339s1c1
Sequence:CCGGGCTGTCAGTCATCGTGACATTCTCGAGAATGTCACGATGACTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-1737s1c1
Sequence:CCGGCATCGGCCACAATGAAGTGATCTCGAGATCACTTCATTGTGGCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-710s1c1
Sequence:CCGGGAGTCAAACCAAGCCAGACATCTCGAGATGTCTGGCTTGGTTTGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016663.3-1778s21c1
Sequence:CCGGGCATCGCAGTGGTAGACTATGCTCGAGCATAGTCTACCACTGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016663.3-312s21c1
Sequence:CCGGAGATGCTGATACCAATGATAGCTCGAGCTATCATTGGTATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016663.3-722s21c1
Sequence:CCGGACCTGGACATGGACTCATATCCTCGAGGATATGAGTCCATGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016663.3-1370s21c1
Sequence:CCGGAGCTGCACTTCAGCGTCTATGCTCGAGCATAGACGCTGAAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016663
SYT3 MISSION shRNA shRNA Plasmid DNA
synaptotagmin III
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-1246s1c1
Sequence:CCGGCCCATCTTCAACGAGACGTTTCTCGAGAAACGTCTCGTTGAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-244s1c1
Sequence:CCGGCGAGATGCTGATACCAATGATCTCGAGATCATTGGTATCAGCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-339s1c1
Sequence:CCGGGCTGTCAGTCATCGTGACATTCTCGAGAATGTCACGATGACTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-1737s1c1
Sequence:CCGGCATCGGCCACAATGAAGTGATCTCGAGATCACTTCATTGTGGCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-710s1c1
Sequence:CCGGGAGTCAAACCAAGCCAGACATCTCGAGATGTCTGGCTTGGTTTGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016663.3-1778s21c1
Sequence:CCGGGCATCGCAGTGGTAGACTATGCTCGAGCATAGTCTACCACTGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016663.3-312s21c1
Sequence:CCGGAGATGCTGATACCAATGATAGCTCGAGCTATCATTGGTATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016663.3-722s21c1
Sequence:CCGGACCTGGACATGGACTCATATCCTCGAGGATATGAGTCCATGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016663.3-1370s21c1
Sequence:CCGGAGCTGCACTTCAGCGTCTATGCTCGAGCATAGACGCTGAAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016663
SYT3 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin III
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-1246s1c1
Sequence:CCGGCCCATCTTCAACGAGACGTTTCTCGAGAAACGTCTCGTTGAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-244s1c1
Sequence:CCGGCGAGATGCTGATACCAATGATCTCGAGATCATTGGTATCAGCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-339s1c1
Sequence:CCGGGCTGTCAGTCATCGTGACATTCTCGAGAATGTCACGATGACTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-1737s1c1
Sequence:CCGGCATCGGCCACAATGAAGTGATCTCGAGATCACTTCATTGTGGCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016663.2-710s1c1
Sequence:CCGGGAGTCAAACCAAGCCAGACATCTCGAGATGTCTGGCTTGGTTTGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016663.3-1778s21c1
Sequence:CCGGGCATCGCAGTGGTAGACTATGCTCGAGCATAGTCTACCACTGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016663.3-312s21c1
Sequence:CCGGAGATGCTGATACCAATGATAGCTCGAGCTATCATTGGTATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016663.3-722s21c1
Sequence:CCGGACCTGGACATGGACTCATATCCTCGAGGATATGAGTCCATGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016663.3-1370s21c1
Sequence:CCGGAGCTGCACTTCAGCGTCTATGCTCGAGCATAGACGCTGAAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032298
SYT3 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin III
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-799s1c1
Sequence:CCGGGCTGTCGGTCATCGTGACATTCTCGAGAATGTCACGATGACCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-1718s1c1
Sequence:CCGGCCCGTCTTCAATGAGACGTTTCTCGAGAAACGTCTCATTGAAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-733s1c1
Sequence:CCGGCCAGGAGTTCAATGACCGAATCTCGAGATTCGGTCATTGAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-1936s1c1
Sequence:CCGGGCTCAACTTCTCACTCTGCTACTCGAGTAGCAGAGTGAGAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-2072s1c1
Sequence:CCGGCGGCGTCTGAAGAAGCGGAAACTCGAGTTTCCGCTTCTTCAGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032298.1-1426s21c1
Sequence:CCGGCAAACTCATTGGGCAGATTAACTCGAGTTAATCTGCCCAATGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032298.1-1782s21c1
Sequence:CCGGACTTCAGCGTCTATGACTTTGCTCGAGCAAAGTCATAGACGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032298.1-2755s21c1
Sequence:CCGGTTCTCGCCGTGAATGTCAATGCTCGAGCATTGACATTCACGGCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032298.1-1723s21c1
Sequence:CCGGCTTCAATGAGACGTTTCAATTCTCGAGAATTGAAACGTCTCATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032298.1-800s21c1
Sequence:CCGGCTGTCGGTCATCGTGACATTCCTCGAGGAATGTCACGATGACCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032298
SYT3 MISSION shRNA shRNA Plasmid DNA
synaptotagmin III
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-799s1c1
Sequence:CCGGGCTGTCGGTCATCGTGACATTCTCGAGAATGTCACGATGACCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-1718s1c1
Sequence:CCGGCCCGTCTTCAATGAGACGTTTCTCGAGAAACGTCTCATTGAAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-733s1c1
Sequence:CCGGCCAGGAGTTCAATGACCGAATCTCGAGATTCGGTCATTGAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-1936s1c1
Sequence:CCGGGCTCAACTTCTCACTCTGCTACTCGAGTAGCAGAGTGAGAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-2072s1c1
Sequence:CCGGCGGCGTCTGAAGAAGCGGAAACTCGAGTTTCCGCTTCTTCAGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032298.1-1426s21c1
Sequence:CCGGCAAACTCATTGGGCAGATTAACTCGAGTTAATCTGCCCAATGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032298.1-1782s21c1
Sequence:CCGGACTTCAGCGTCTATGACTTTGCTCGAGCAAAGTCATAGACGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032298.1-2755s21c1
Sequence:CCGGTTCTCGCCGTGAATGTCAATGCTCGAGCATTGACATTCACGGCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032298.1-1723s21c1
Sequence:CCGGCTTCAATGAGACGTTTCAATTCTCGAGAATTGAAACGTCTCATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032298.1-800s21c1
Sequence:CCGGCTGTCGGTCATCGTGACATTCCTCGAGGAATGTCACGATGACCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032298
SYT3 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin III
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-799s1c1
Sequence:CCGGGCTGTCGGTCATCGTGACATTCTCGAGAATGTCACGATGACCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-1718s1c1
Sequence:CCGGCCCGTCTTCAATGAGACGTTTCTCGAGAAACGTCTCATTGAAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-733s1c1
Sequence:CCGGCCAGGAGTTCAATGACCGAATCTCGAGATTCGGTCATTGAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-1936s1c1
Sequence:CCGGGCTCAACTTCTCACTCTGCTACTCGAGTAGCAGAGTGAGAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032298.1-2072s1c1
Sequence:CCGGCGGCGTCTGAAGAAGCGGAAACTCGAGTTTCCGCTTCTTCAGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032298.1-1426s21c1
Sequence:CCGGCAAACTCATTGGGCAGATTAACTCGAGTTAATCTGCCCAATGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032298.1-1782s21c1
Sequence:CCGGACTTCAGCGTCTATGACTTTGCTCGAGCAAAGTCATAGACGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032298.1-2755s21c1
Sequence:CCGGTTCTCGCCGTGAATGTCAATGCTCGAGCATTGACATTCACGGCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032298.1-1723s21c1
Sequence:CCGGCTTCAATGAGACGTTTCAATTCTCGAGAATTGAAACGTCTCATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032298.1-800s21c1
Sequence:CCGGCTGTCGGTCATCGTGACATTCCTCGAGGAATGTCACGATGACCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks