EMAIL THIS PAGE TO A FRIEND

SYT4

synaptotagmin IV

Synonyms: HsT1192
UniProtKB ID: Q9H2B2, Q9P2K4
Gene ID:
Mouse(20983) synaptotagmin IV
Rat(64440) synaptotagmin IV
naked mole-rat(101722811) synaptotagmin IV
cow(539867) synaptotagmin IV
sheep(101104950) synaptotagmin IV
fruit fly(40876) Synaptotagmin 4
Horse(100068405) synaptotagmin IV
domestic cat(101100162) synaptotagmin IV
dog(490474) synaptotagmin IV
chicken(422960) synaptotagmin IV
Zebrafish(335357) synaptotagmin IV
211 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009308 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009308 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009308 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020783 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020783 Rosetta Predictions human pricing
NM_031693 Rosetta Predictions rat pricing
NM_009308 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194273 predicted 360
2 SASI_Hs01_00194274 predicted 1007
3 SASI_Hs01_00194275 predicted 309
4 SASI_Hs01_00194276 predicted 259
5 SASI_Hs01_00194278 predicted 1458
6 SASI_Hs01_00194279 predicted 693
7 SASI_Hs01_00194280 predicted 230
8 SASI_Hs01_00194281 predicted 758
9 SASI_Hs01_00194282 predicted 1028
10 SASI_Hs02_00353939 predicted 556
11 SASI_Hs01_00194277 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265038 predicted 481
2 SASI_Rn02_00265039 predicted 1493
3 SASI_Rn02_00265040 predicted 1121
4 SASI_Rn02_00265041 predicted 806
5 SASI_Rn02_00265042 predicted 734
6 SASI_Rn02_00265043 predicted 1297
7 SASI_Rn02_00265044 predicted 365
8 SASI_Rn02_00265045 predicted 712
9 SASI_Rn02_00265046 predicted 980
10 SASI_Rn02_00265047 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114331 predicted 373
2 SASI_Mm01_00114332 predicted 527
3 SASI_Mm01_00114333 predicted 1128
4 SASI_Mm01_00114334 predicted 365
5 SASI_Mm01_00114335 predicted 1279
6 SASI_Mm02_00315840 predicted 751
7 SASI_Mm01_00114336 predicted 915
8 SASI_Mm01_00114338 predicted 724
9 SASI_Mm01_00114339 predicted 1334
10 SASI_Mm02_00315841 predicted 1328
11 SASI_Mm01_00114337 predicted 1119
12 SASI_Mm01_00114340 predicted 1198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009308
VALIDATED
SYT4 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin IV
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-1393s21c1
Sequence:GTACCGGGATCCCGAAATGAGGTGATTGCTCGAGCAATCACCTCATTTCGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-388s21c1
Sequence:GTACCGGAGACTCCTCCATACAAGTTTGCTCGAGCAAACTTGTATGGAGGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-1196s21c1
Sequence:GTACCGGATCTGATGTGTCTGGACTTTCCTCGAGGAAAGTCCAGACACATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-481s21c1
Sequence:GTACCGGAGAGTGAAGTGAAGGGTAAAGCTCGAGCTTTACCCTTCACTTCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-739s21c1
Sequence:GTACCGGACTTCGAGAAGAAAGCATTTGCTCGAGCAAATGCTTTCTTCTCGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009308.3-1280s1c1
Sequence:CCGGCGTTAAGAAATGCACTCCCAACTCGAGTTGGGAGTGCATTTCTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009308.3-732s1c1
Sequence:CCGGGAGTACAACTTCGAGAAGAAACTCGAGTTTCTTCTCGAAGTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009308.3-473s1c1
Sequence:CCGGAGATGACAAGAGTGAAGTGAACTCGAGTTCACTTCACTCTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009308.3-1483s1c1
Sequence:CCGGCCAGGAGACAAATTGCTAAGTCTCGAGACTTAGCAATTTGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009308.3-2683s1c1
Sequence:CCGGGCTGTCTTTAGACGCCAGTTTCTCGAGAAACTGGCGTCTAAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009308
VALIDATED
SYT4 MISSION shRNA shRNA Plasmid DNA
synaptotagmin IV
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-1393s21c1
Sequence:GTACCGGGATCCCGAAATGAGGTGATTGCTCGAGCAATCACCTCATTTCGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-388s21c1
Sequence:GTACCGGAGACTCCTCCATACAAGTTTGCTCGAGCAAACTTGTATGGAGGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-1196s21c1
Sequence:GTACCGGATCTGATGTGTCTGGACTTTCCTCGAGGAAAGTCCAGACACATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-481s21c1
Sequence:GTACCGGAGAGTGAAGTGAAGGGTAAAGCTCGAGCTTTACCCTTCACTTCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-739s21c1
Sequence:GTACCGGACTTCGAGAAGAAAGCATTTGCTCGAGCAAATGCTTTCTTCTCGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009308.3-1280s1c1
Sequence:CCGGCGTTAAGAAATGCACTCCCAACTCGAGTTGGGAGTGCATTTCTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009308.3-732s1c1
Sequence:CCGGGAGTACAACTTCGAGAAGAAACTCGAGTTTCTTCTCGAAGTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009308.3-473s1c1
Sequence:CCGGAGATGACAAGAGTGAAGTGAACTCGAGTTCACTTCACTCTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009308.3-1483s1c1
Sequence:CCGGCCAGGAGACAAATTGCTAAGTCTCGAGACTTAGCAATTTGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009308.3-2683s1c1
Sequence:CCGGGCTGTCTTTAGACGCCAGTTTCTCGAGAAACTGGCGTCTAAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009308
VALIDATED
SYT4 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin IV
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-1393s21c1
Sequence:GTACCGGGATCCCGAAATGAGGTGATTGCTCGAGCAATCACCTCATTTCGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-388s21c1
Sequence:GTACCGGAGACTCCTCCATACAAGTTTGCTCGAGCAAACTTGTATGGAGGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-1196s21c1
Sequence:GTACCGGATCTGATGTGTCTGGACTTTCCTCGAGGAAAGTCCAGACACATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-481s21c1
Sequence:GTACCGGAGAGTGAAGTGAAGGGTAAAGCTCGAGCTTTACCCTTCACTTCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009308.3-739s21c1
Sequence:GTACCGGACTTCGAGAAGAAAGCATTTGCTCGAGCAAATGCTTTCTTCTCGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009308.3-1280s1c1
Sequence:CCGGCGTTAAGAAATGCACTCCCAACTCGAGTTGGGAGTGCATTTCTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009308.3-732s1c1
Sequence:CCGGGAGTACAACTTCGAGAAGAAACTCGAGTTTCTTCTCGAAGTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009308.3-473s1c1
Sequence:CCGGAGATGACAAGAGTGAAGTGAACTCGAGTTCACTTCACTCTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009308.3-1483s1c1
Sequence:CCGGCCAGGAGACAAATTGCTAAGTCTCGAGACTTAGCAATTTGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009308.3-2683s1c1
Sequence:CCGGGCTGTCTTTAGACGCCAGTTTCTCGAGAAACTGGCGTCTAAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020783
SYT4 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin IV
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020783.3-1654s21c1
Sequence:GTACCGGAGCCGTGAGTTGGAACTTAAACTCGAGTTTAAGTTCCAACTCACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020783.3-1765s21c1
Sequence:GTACCGGTGCTAGAAATGGATTGAATTACTCGAGTAATTCAATCCATTTCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020783.3-1880s21c1
Sequence:GTACCGGTCAGATTACCAGTGATATAACCTCGAGGTTATATCACTGGTAATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020783.3-930s21c1
Sequence:GTACCGGGATGACCTCTGACCCATATATCTCGAGATATATGGGTCAGAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020783.3-1523s21c1
Sequence:GTACCGGATGAGGTAATCGGGCAGTTAGCTCGAGCTAACTGCCCGATTACCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020783.3-536s21c1
Sequence:GTACCGGTGCTTAAGGGAGTTGATATTTCTCGAGAAATATCAACTCCCTTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020783.x-1029s1c1
Sequence:CCGGGCTCGACATCTGCCTAAATCTCTCGAGAGATTTAGGCAGATGTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020783.x-1067s1c1
Sequence:CCGGAGATCCCTATGTCAAAGTGAACTCGAGTTCACTTTGACATAGGGATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020783.x-1301s1c1
Sequence:CCGGTGGAGAGCACTGGAAAGAGATCTCGAGATCTCTTTCCAGTGCTCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020783.x-1971s1c1
Sequence:CCGGGTGAACAAGCTGAGAAATTATCTCGAGATAATTTCTCAGCTTGTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020783.x-783s1c1
Sequence:CCGGCCCTACACACAAATCCAAGAACTCGAGTTCTTGGATTTGTGTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020783
SYT4 MISSION shRNA shRNA Plasmid DNA
synaptotagmin IV
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020783.3-1654s21c1
Sequence:GTACCGGAGCCGTGAGTTGGAACTTAAACTCGAGTTTAAGTTCCAACTCACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020783.3-1765s21c1
Sequence:GTACCGGTGCTAGAAATGGATTGAATTACTCGAGTAATTCAATCCATTTCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020783.3-1880s21c1
Sequence:GTACCGGTCAGATTACCAGTGATATAACCTCGAGGTTATATCACTGGTAATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020783.3-930s21c1
Sequence:GTACCGGGATGACCTCTGACCCATATATCTCGAGATATATGGGTCAGAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020783.3-1523s21c1
Sequence:GTACCGGATGAGGTAATCGGGCAGTTAGCTCGAGCTAACTGCCCGATTACCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020783.3-536s21c1
Sequence:GTACCGGTGCTTAAGGGAGTTGATATTTCTCGAGAAATATCAACTCCCTTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020783.x-1029s1c1
Sequence:CCGGGCTCGACATCTGCCTAAATCTCTCGAGAGATTTAGGCAGATGTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020783.x-1067s1c1
Sequence:CCGGAGATCCCTATGTCAAAGTGAACTCGAGTTCACTTTGACATAGGGATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020783.x-1301s1c1
Sequence:CCGGTGGAGAGCACTGGAAAGAGATCTCGAGATCTCTTTCCAGTGCTCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020783.x-1971s1c1
Sequence:CCGGGTGAACAAGCTGAGAAATTATCTCGAGATAATTTCTCAGCTTGTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020783.x-783s1c1
Sequence:CCGGCCCTACACACAAATCCAAGAACTCGAGTTCTTGGATTTGTGTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020783
SYT4 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin IV
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020783.3-1654s21c1
Sequence:GTACCGGAGCCGTGAGTTGGAACTTAAACTCGAGTTTAAGTTCCAACTCACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020783.3-1765s21c1
Sequence:GTACCGGTGCTAGAAATGGATTGAATTACTCGAGTAATTCAATCCATTTCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020783.3-1880s21c1
Sequence:GTACCGGTCAGATTACCAGTGATATAACCTCGAGGTTATATCACTGGTAATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020783.3-930s21c1
Sequence:GTACCGGGATGACCTCTGACCCATATATCTCGAGATATATGGGTCAGAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020783.3-1523s21c1
Sequence:GTACCGGATGAGGTAATCGGGCAGTTAGCTCGAGCTAACTGCCCGATTACCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020783.3-536s21c1
Sequence:GTACCGGTGCTTAAGGGAGTTGATATTTCTCGAGAAATATCAACTCCCTTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020783.x-1029s1c1
Sequence:CCGGGCTCGACATCTGCCTAAATCTCTCGAGAGATTTAGGCAGATGTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020783.x-1067s1c1
Sequence:CCGGAGATCCCTATGTCAAAGTGAACTCGAGTTCACTTTGACATAGGGATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020783.x-1301s1c1
Sequence:CCGGTGGAGAGCACTGGAAAGAGATCTCGAGATCTCTTTCCAGTGCTCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020783.x-1971s1c1
Sequence:CCGGGTGAACAAGCTGAGAAATTATCTCGAGATAATTTCTCAGCTTGTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020783.x-783s1c1
Sequence:CCGGCCCTACACACAAATCCAAGAACTCGAGTTCTTGGATTTGTGTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks