EMAIL THIS PAGE TO A FRIEND

SYT5

synaptotagmin V

UniProtKB ID: O00445, B3KWJ8, Q86X72
Gene ID:
Human(6861) Summary: Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C (see MIM 176960) regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators of vesicle fusion, allowing fusion in the presence of calcium, and as calcium receptors or sensor molecules (summary by Hudson and Birnbaum, 1995 [PubMed 7597049]
Mouse(53420) synaptotagmin V
Rat(54309) synaptotagmin V
dog(476382) synaptotagmin V
domestic cat(101086106) synaptotagmin V
cow(539616) synaptotagmin V
naked mole-rat(101713220) synaptotagmin V
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304887 ANTI-SYT5 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2502087 Anti-Syt5 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, pig, mouse, bovine, human
ELISA, western blot pricing
SAB2107399 Anti-SYT5 antibody produced in rabbit affinity isolated antibody human, horse, guinea pig
ELISA, western blot pricing
SAB5201023 Monoclonal Anti-Synaptotagmin-9 - Alkaline Phosphatase antibody produced in mouse clone S276-15, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201024 Monoclonal Anti-Synaptotagmin-9 - Apc antibody produced in mouse clone S276-15, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201015 Monoclonal Anti-Synaptotagmin-9 - Atto 390 antibody produced in mouse clone S276-15, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201016 Monoclonal Anti-Synaptotagmin-9 - Atto 488 antibody produced in mouse clone S276-15, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201017 Monoclonal Anti-Synaptotagmin-9 - Atto 565 antibody produced in mouse clone S276-15, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201018 Monoclonal Anti-Synaptotagmin-9 - Atto 594 antibody produced in mouse clone S276-15, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201019 Monoclonal Anti-Synaptotagmin-9 - Atto 633 antibody produced in mouse clone S276-15, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201020 Monoclonal Anti-Synaptotagmin-9 - Atto 655 antibody produced in mouse clone S276-15, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201021 Monoclonal Anti-Synaptotagmin-9 - Atto 680 antibody produced in mouse clone S276-15, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201022 Monoclonal Anti-Synaptotagmin-9 - Atto 700 antibody produced in mouse clone S276-15, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201025 Monoclonal Anti-Synaptotagmin-9 - Biotin antibody produced in mouse clone S276-15, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201026 Monoclonal Anti-Synaptotagmin-9 - Fitc antibody produced in mouse clone S276-15, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201027 Monoclonal Anti-Synaptotagmin-9 - Hrp antibody produced in mouse clone S276-15, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201028 Monoclonal Anti-Synaptotagmin-9 - Pe/Atto 594 antibody produced in mouse clone S276-15, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201029 Monoclonal Anti-Synaptotagmin-9 - Percp antibody produced in mouse clone S276-15, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201030 Monoclonal Anti-Synaptotagmin-9 - Rpe antibody produced in mouse clone S276-15, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201031 Monoclonal Anti-Synaptotagmin-9 - Streptavidin antibody produced in mouse clone S276-15, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201014 Monoclonal Anti-Synaptotagmin-9 antibody produced in mouse clone S276-15, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016908 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016908 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016908 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003180 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU041231 MISSION® esiRNA esiRNA targeting mouse Syt5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003180 Rosetta Predictions human pricing
NM_019350 Rosetta Predictions rat pricing
NM_016908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076309 predicted 1574
2 SASI_Hs01_00076311 predicted 1086
3 SASI_Hs01_00076312 predicted 732
4 SASI_Hs01_00076313 predicted 607
5 SASI_Hs01_00076315 predicted 626
6 SASI_Hs01_00076316 predicted 1054
7 SASI_Hs01_00076317 predicted 527
8 SASI_Hs01_00076318 predicted 754
9 SASI_Hs02_00335205 predicted 611
10 SASI_Hs02_00335206 predicted 671
11 SASI_Hs01_00076310 predicted 676
12 SASI_Hs01_00076314 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037010 predicted 1444
2 SASI_Rn01_00037011 predicted 1090
3 SASI_Rn01_00037012 predicted 1391
4 SASI_Rn01_00037013 predicted 879
5 SASI_Rn02_00262353 predicted 443
6 SASI_Rn01_00037015 predicted 556
7 SASI_Rn01_00037016 predicted 1470
8 SASI_Rn01_00037017 predicted 924
9 SASI_Rn01_00037018 predicted 605
10 SASI_Rn01_00037019 predicted 654
11 SASI_Rn01_00037014 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168041 predicted 1028
2 SASI_Mm02_00323760 predicted 1397
3 SASI_Mm01_00168042 predicted 1053
4 SASI_Mm01_00168043 predicted 1399
5 SASI_Mm01_00168044 predicted 1493
6 SASI_Mm01_00168045 predicted 485
7 SASI_Mm01_00168046 predicted 781
8 SASI_Mm01_00168047 predicted 1493
9 SASI_Mm01_00168048 predicted 1409
10 SASI_Mm01_00168050 predicted 699
11 SASI_Mm01_00168049 predicted 1185
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016908
SYT5 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin V
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016908.2-1533s1c1
Sequence:CCGGCCATCCAATACCACTCCTATACTCGAGTATAGGAGTGGTATTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016908.2-766s1c1
Sequence:CCGGTCCACACTTTGGAGAGACATTCTCGAGAATGTCTCTCCAAAGTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016908.2-767s1c1
Sequence:CCGGCCACACTTTGGAGAGACATTTCTCGAGAAATGTCTCTCCAAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016908.2-491s1c1
Sequence:CCGGCGGAGTTACATAGATAAGGTTCTCGAGAACCTTATCTATGTAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016908.2-1027s1c1
Sequence:CCGGCGTCATTGTCTTGGAAGCTAACTCGAGTTAGCTTCCAAGACAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-682s21c1
Sequence:CCGGTTCCTCAGATCCCTATGTTAGCTCGAGCTAACATAGGGATCTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016908.2-1534s21c1
Sequence:CCGGCATCCAATACCACTCCTATACCTCGAGGTATAGGAGTGGTATTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-1230s21c1
Sequence:CCGGAGCTGACTGTTCTGGATTATGCTCGAGCATAATCCAGAACAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-984s21c1
Sequence:CCGGTCTGCTTCTCTCTCCGTTATGCTCGAGCATAACGGAGAGAGAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016908.2-1501s21c1
Sequence:CCGGTCCTACTTCCACATTGGAAATCTCGAGATTTCCAATGTGGAAGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-579s21c1
Sequence:CCGGAGCTAGGCCGACTGCAGTATTCTCGAGAATACTGCAGTCGGCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-768s21c1
Sequence:CCGGCACACTTTGGAGAGACATTTGCTCGAGCAAATGTCTCTCCAAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016908
SYT5 MISSION shRNA shRNA Plasmid DNA
synaptotagmin V
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016908.2-1533s1c1
Sequence:CCGGCCATCCAATACCACTCCTATACTCGAGTATAGGAGTGGTATTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016908.2-766s1c1
Sequence:CCGGTCCACACTTTGGAGAGACATTCTCGAGAATGTCTCTCCAAAGTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016908.2-767s1c1
Sequence:CCGGCCACACTTTGGAGAGACATTTCTCGAGAAATGTCTCTCCAAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016908.2-491s1c1
Sequence:CCGGCGGAGTTACATAGATAAGGTTCTCGAGAACCTTATCTATGTAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016908.2-1027s1c1
Sequence:CCGGCGTCATTGTCTTGGAAGCTAACTCGAGTTAGCTTCCAAGACAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-682s21c1
Sequence:CCGGTTCCTCAGATCCCTATGTTAGCTCGAGCTAACATAGGGATCTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016908.2-1534s21c1
Sequence:CCGGCATCCAATACCACTCCTATACCTCGAGGTATAGGAGTGGTATTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-1230s21c1
Sequence:CCGGAGCTGACTGTTCTGGATTATGCTCGAGCATAATCCAGAACAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-984s21c1
Sequence:CCGGTCTGCTTCTCTCTCCGTTATGCTCGAGCATAACGGAGAGAGAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016908.2-1501s21c1
Sequence:CCGGTCCTACTTCCACATTGGAAATCTCGAGATTTCCAATGTGGAAGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-579s21c1
Sequence:CCGGAGCTAGGCCGACTGCAGTATTCTCGAGAATACTGCAGTCGGCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-768s21c1
Sequence:CCGGCACACTTTGGAGAGACATTTGCTCGAGCAAATGTCTCTCCAAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016908
SYT5 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin V
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016908.2-1533s1c1
Sequence:CCGGCCATCCAATACCACTCCTATACTCGAGTATAGGAGTGGTATTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016908.2-766s1c1
Sequence:CCGGTCCACACTTTGGAGAGACATTCTCGAGAATGTCTCTCCAAAGTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016908.2-767s1c1
Sequence:CCGGCCACACTTTGGAGAGACATTTCTCGAGAAATGTCTCTCCAAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016908.2-491s1c1
Sequence:CCGGCGGAGTTACATAGATAAGGTTCTCGAGAACCTTATCTATGTAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016908.2-1027s1c1
Sequence:CCGGCGTCATTGTCTTGGAAGCTAACTCGAGTTAGCTTCCAAGACAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-682s21c1
Sequence:CCGGTTCCTCAGATCCCTATGTTAGCTCGAGCTAACATAGGGATCTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016908.2-1534s21c1
Sequence:CCGGCATCCAATACCACTCCTATACCTCGAGGTATAGGAGTGGTATTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-1230s21c1
Sequence:CCGGAGCTGACTGTTCTGGATTATGCTCGAGCATAATCCAGAACAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-984s21c1
Sequence:CCGGTCTGCTTCTCTCTCCGTTATGCTCGAGCATAACGGAGAGAGAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016908.2-1501s21c1
Sequence:CCGGTCCTACTTCCACATTGGAAATCTCGAGATTTCCAATGTGGAAGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-579s21c1
Sequence:CCGGAGCTAGGCCGACTGCAGTATTCTCGAGAATACTGCAGTCGGCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016908.2-768s21c1
Sequence:CCGGCACACTTTGGAGAGACATTTGCTCGAGCAAATGTCTCTCCAAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003180
VALIDATED
SYT5 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin V
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003180.x-742s1c1
Sequence:CCGGCCAGAGTTACATAGACAAGGTCTCGAGACCTTGTCTATGTAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003180.x-1304s1c1
Sequence:CCGGCTGAAGAAGATGGACGTAGGACTCGAGTCCTACGTCCATCTTCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003180.x-1333s1c1
Sequence:CCGGAGATCCATACGTCAAGGTCCACTCGAGTGGACCTTGACGTATGGATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003180.x-1419s1c1
Sequence:CCGGCCTATTACAACGAAGCTTTCACTCGAGTGAAAGCTTCGTTGTAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-873s21c1
Sequence:GTACCGGTTCGACCGCTTCTCTCGCAATCTCGAGATTGCGAGAGAAGCGGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-405s21c1
Sequence:CCGGCTCATCTTCAGCTGCTGTTTCCTCGAGGAAACAGCAGCTGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-1053s21c1
Sequence:CCGGGTCATCGTCCTGGAGGCTAAACTCGAGTTTAGCCTCCAGGACGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003180.2-1617s21c1
Sequence:CCGGTCACGACAACTTTCCAGCACACTCGAGTGTGCTGGAAAGTTGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-616s21c1
Sequence:CCGGTGCAGTACTCCCTGGATTATGCTCGAGCATAATCCAGGGAGTACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-781s21c1
Sequence:CCGGAGACGCTGAACCCTCACTTTGCTCGAGCAAAGTGAGGGTTCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-1100s21c1
Sequence:GTACCGGACTGTCAGATCCATACGTCAACTCGAGTTGACGTATGGATCTGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003180.2-1531s21c1
Sequence:GTACCGGTAAGCTTCCTCTGACGGTTACCTCGAGGTAACCGTCAGAGGAAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-660s21c1
Sequence:GTACCGGGTGGGCATTCTGCAAGCAATGCTCGAGCATTGCTTGCAGAATGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-1075s21c1
Sequence:GTACCGGACCTGAAGAAGATGGACGTAGCTCGAGCTACGTCCATCTTCTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003180
VALIDATED
SYT5 MISSION shRNA shRNA Plasmid DNA
synaptotagmin V
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003180.x-742s1c1
Sequence:CCGGCCAGAGTTACATAGACAAGGTCTCGAGACCTTGTCTATGTAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003180.x-1304s1c1
Sequence:CCGGCTGAAGAAGATGGACGTAGGACTCGAGTCCTACGTCCATCTTCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003180.x-1333s1c1
Sequence:CCGGAGATCCATACGTCAAGGTCCACTCGAGTGGACCTTGACGTATGGATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003180.x-1419s1c1
Sequence:CCGGCCTATTACAACGAAGCTTTCACTCGAGTGAAAGCTTCGTTGTAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-873s21c1
Sequence:GTACCGGTTCGACCGCTTCTCTCGCAATCTCGAGATTGCGAGAGAAGCGGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-405s21c1
Sequence:CCGGCTCATCTTCAGCTGCTGTTTCCTCGAGGAAACAGCAGCTGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-1053s21c1
Sequence:CCGGGTCATCGTCCTGGAGGCTAAACTCGAGTTTAGCCTCCAGGACGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003180.2-1617s21c1
Sequence:CCGGTCACGACAACTTTCCAGCACACTCGAGTGTGCTGGAAAGTTGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-616s21c1
Sequence:CCGGTGCAGTACTCCCTGGATTATGCTCGAGCATAATCCAGGGAGTACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-781s21c1
Sequence:CCGGAGACGCTGAACCCTCACTTTGCTCGAGCAAAGTGAGGGTTCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-1100s21c1
Sequence:GTACCGGACTGTCAGATCCATACGTCAACTCGAGTTGACGTATGGATCTGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003180.2-1531s21c1
Sequence:GTACCGGTAAGCTTCCTCTGACGGTTACCTCGAGGTAACCGTCAGAGGAAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-660s21c1
Sequence:GTACCGGGTGGGCATTCTGCAAGCAATGCTCGAGCATTGCTTGCAGAATGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-1075s21c1
Sequence:GTACCGGACCTGAAGAAGATGGACGTAGCTCGAGCTACGTCCATCTTCTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003180
VALIDATED
SYT5 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin V
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003180.x-742s1c1
Sequence:CCGGCCAGAGTTACATAGACAAGGTCTCGAGACCTTGTCTATGTAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003180.x-1304s1c1
Sequence:CCGGCTGAAGAAGATGGACGTAGGACTCGAGTCCTACGTCCATCTTCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003180.x-1333s1c1
Sequence:CCGGAGATCCATACGTCAAGGTCCACTCGAGTGGACCTTGACGTATGGATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003180.x-1419s1c1
Sequence:CCGGCCTATTACAACGAAGCTTTCACTCGAGTGAAAGCTTCGTTGTAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-873s21c1
Sequence:GTACCGGTTCGACCGCTTCTCTCGCAATCTCGAGATTGCGAGAGAAGCGGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-405s21c1
Sequence:CCGGCTCATCTTCAGCTGCTGTTTCCTCGAGGAAACAGCAGCTGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-1053s21c1
Sequence:CCGGGTCATCGTCCTGGAGGCTAAACTCGAGTTTAGCCTCCAGGACGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003180.2-1617s21c1
Sequence:CCGGTCACGACAACTTTCCAGCACACTCGAGTGTGCTGGAAAGTTGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-616s21c1
Sequence:CCGGTGCAGTACTCCCTGGATTATGCTCGAGCATAATCCAGGGAGTACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-781s21c1
Sequence:CCGGAGACGCTGAACCCTCACTTTGCTCGAGCAAAGTGAGGGTTCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-1100s21c1
Sequence:GTACCGGACTGTCAGATCCATACGTCAACTCGAGTTGACGTATGGATCTGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003180.2-1531s21c1
Sequence:GTACCGGTAAGCTTCCTCTGACGGTTACCTCGAGGTAACCGTCAGAGGAAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-660s21c1
Sequence:GTACCGGGTGGGCATTCTGCAAGCAATGCTCGAGCATTGCTTGCAGAATGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003180.2-1075s21c1
Sequence:GTACCGGACCTGAAGAAGATGGACGTAGCTCGAGCTACGTCCATCTTCTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks