EMAIL THIS PAGE TO A FRIEND

SYT6

synaptotagmin VI

Synonyms: sytVI
UniProtKB ID: Q5T7P8, B1AMB8, B3KPK1
Gene ID:
Human(148281) Summary: The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(54524) synaptotagmin VI
Rat(60565) synaptotagmin VI
chicken(428270) synaptotagmin VI
Horse(100059396) synaptotagmin VI
domestic cat(101080470) synaptotagmin VI
dog(483127) synaptotagmin VI
naked mole-rat(101716992) synaptotagmin VI
Domestic Rabbit(100353541) synaptotagmin VI
cow(537637) synaptotagmin VI
sheep(101122233) synaptotagmin VI
261 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302159 ANTI-SYT6 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2700114 Anti-SYT6 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4300971 Anti-SYT6 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB5200789 Monoclonal Anti-Synaptotagmin-10 - Alkaline Phosphatase antibody produced in mouse clone S269-73, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200790 Monoclonal Anti-Synaptotagmin-10 - Apc antibody produced in mouse clone S269-73, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200781 Monoclonal Anti-Synaptotagmin-10 - Atto 390 antibody produced in mouse clone S269-73, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200782 Monoclonal Anti-Synaptotagmin-10 - Atto 488 antibody produced in mouse clone S269-73, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200783 Monoclonal Anti-Synaptotagmin-10 - Atto 565 antibody produced in mouse clone S269-73, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200784 Monoclonal Anti-Synaptotagmin-10 - Atto 594 antibody produced in mouse clone S269-73, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200785 Monoclonal Anti-Synaptotagmin-10 - Atto 633 antibody produced in mouse clone S269-73, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200786 Monoclonal Anti-Synaptotagmin-10 - Atto 655 antibody produced in mouse clone S269-73, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200787 Monoclonal Anti-Synaptotagmin-10 - Atto 680 antibody produced in mouse clone S269-73, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200788 Monoclonal Anti-Synaptotagmin-10 - Atto 700 antibody produced in mouse clone S269-73, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200791 Monoclonal Anti-Synaptotagmin-10 - Biotin antibody produced in mouse clone S269-73, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200792 Monoclonal Anti-Synaptotagmin-10 - Fitc antibody produced in mouse clone S269-73, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200793 Monoclonal Anti-Synaptotagmin-10 - Hrp antibody produced in mouse clone S269-73, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200794 Monoclonal Anti-Synaptotagmin-10 - Pe/Atto 594 antibody produced in mouse clone S269-73, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200795 Monoclonal Anti-Synaptotagmin-10 - Percp antibody produced in mouse clone S269-73, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200796 Monoclonal Anti-Synaptotagmin-10 - Rpe antibody produced in mouse clone S269-73, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200797 Monoclonal Anti-Synaptotagmin-10 - Streptavidin antibody produced in mouse clone S269-73, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200780 Monoclonal Anti-Synaptotagmin-10 antibody produced in mouse clone S269-73, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200825 Monoclonal Anti-Synaptotagmin-6 - Alkaline Phosphatase antibody produced in mouse clone S270-47, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5200826 Monoclonal Anti-Synaptotagmin-6 - Apc antibody produced in mouse clone S270-47, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200817 Monoclonal Anti-Synaptotagmin-6 - Atto 390 antibody produced in mouse clone S270-47, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200818 Monoclonal Anti-Synaptotagmin-6 - Atto 488 antibody produced in mouse clone S270-47, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB5200819 Monoclonal Anti-Synaptotagmin-6 - Atto 565 antibody produced in mouse clone S270-47, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200820 Monoclonal Anti-Synaptotagmin-6 - Atto 594 antibody produced in mouse clone S270-47, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200821 Monoclonal Anti-Synaptotagmin-6 - Atto 633 antibody produced in mouse clone S270-47, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200822 Monoclonal Anti-Synaptotagmin-6 - Atto 655 antibody produced in mouse clone S270-47, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5200823 Monoclonal Anti-Synaptotagmin-6 - Atto 680 antibody produced in mouse clone S270-47, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5200824 Monoclonal Anti-Synaptotagmin-6 - Atto 700 antibody produced in mouse clone S270-47, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5200827 Monoclonal Anti-Synaptotagmin-6 - Biotin antibody produced in mouse clone S270-47, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200828 Monoclonal Anti-Synaptotagmin-6 - Fitc antibody produced in mouse clone S270-47, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200829 Monoclonal Anti-Synaptotagmin-6 - Hrp antibody produced in mouse clone S270-47, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200830 Monoclonal Anti-Synaptotagmin-6 - Pe/Atto 594 antibody produced in mouse clone S270-47, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200831 Monoclonal Anti-Synaptotagmin-6 - Percp antibody produced in mouse clone S270-47, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200832 Monoclonal Anti-Synaptotagmin-6 - Rpe antibody produced in mouse clone S270-47, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200833 Monoclonal Anti-Synaptotagmin-6 - Streptavidin antibody produced in mouse clone S270-47, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200816 Monoclonal Anti-Synaptotagmin-6 antibody produced in mouse clone S270-47, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_205848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_205848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_205848 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024611 MISSION® esiRNA esiRNA human SYT6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_205848 Rosetta Predictions human pricing
NM_022191 Rosetta Predictions rat pricing
NM_018800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030309 predicted 605
2 SASI_Hs01_00030310 predicted 1077
3 SASI_Hs01_00030311 predicted 868
4 SASI_Hs01_00030312 predicted 1521
5 SASI_Hs01_00030314 predicted 1620
6 SASI_Hs01_00030315 predicted 1571
7 SASI_Hs01_00030316 predicted 1333
8 SASI_Hs01_00030317 predicted 1128
9 SASI_Hs01_00030318 predicted 930
10 SASI_Hs02_00373478 predicted 532
11 SASI_Hs01_00030313 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035261 predicted 1374
2 SASI_Rn01_00035262 predicted 741
3 SASI_Rn01_00035263 predicted 1458
4 SASI_Rn01_00035264 predicted 890
5 SASI_Rn01_00035265 predicted 1075
6 SASI_Rn01_00035266 predicted 1163
7 SASI_Rn01_00035267 predicted 1484
8 SASI_Rn01_00035268 predicted 900
9 SASI_Rn01_00035269 predicted 995
10 SASI_Rn01_00035270 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091238 predicted 1299
2 SASI_Mm01_00091239 predicted 1098
3 SASI_Mm01_00091240 predicted 714
4 SASI_Mm02_00324125 predicted 856
5 SASI_Mm02_00324126 predicted 829
6 SASI_Mm01_00091241 predicted 1264
7 SASI_Mm01_00091244 predicted 1551
8 SASI_Mm01_00091245 predicted 1623
9 SASI_Mm01_00091246 predicted 890
10 SASI_Mm01_00091247 predicted 1180
11 SASI_Mm01_00091242 predicted 1539
12 SASI_Mm01_00091243 predicted 976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205848
VALIDATED
SYT6 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin VI
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1165s21c1
Sequence:GTACCGGGATGGACATCACAGGCTATTCCTCGAGGAATAGCCTGTGATGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1511s21c1
Sequence:GTACCGGGGAAACCCTCGGTTGTGATTTCTCGAGAAATCACAACCGAGGGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1475s21c1
Sequence:CCGGCACTCCTTGGTGGAGGTAAAGCTCGAGCTTTACCTCCACCAAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-933s21c1
Sequence:CCGGATCTCAGTGTCTTCGACTTTGCTCGAGCAAAGTCGAAGACACTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_205848.2-1037s21c1
Sequence:CCGGATCTGGAAGGATATCCAATATCTCGAGATATTGGATATCCTTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205848.2-3382s21c1
Sequence:CCGGTAGTCTGGTAGTCCTACATTTCTCGAGAAATGTAGGACTACCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-698s21c1
Sequence:CCGGTTCAGCCTACGCTACGATTACCTCGAGGTAATCGTAGCGTAGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1125s21c1
Sequence:GTACCGGGGCTCACCCTCACAGTGATTACTCGAGTAATCACTGTGAGGGTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205848.2-1698s21c1
Sequence:GTACCGGGCACTTGTTCAACCGTCTAAACTCGAGTTTAGACGGTTGAACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-546s21c1
Sequence:GTACCGGATGTCTCCAGTGTAGACTATGCTCGAGCATAGTCTACACTGGAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1263s21c1
Sequence:GTACCGGCTCTCAATCCTGTCTACAATGCTCGAGCATTGTAGACAGGATTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205848.2-1648s21c1
Sequence:GTACCGGATGAGATGTGCAGCCAAATAACTCGAGTTATTTGGCTGCACATCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205848.1-1060s1c1
Sequence:CCGGCACAAGTGAAAGCGTGGACTTCTCGAGAAGTCCACGCTTTCACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205848.1-1164s1c1
Sequence:CCGGCGATGGACATCACAGGCTATTCTCGAGAATAGCCTGTGATGTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205848.1-1333s1c1
Sequence:CCGGGCTCATCTCAGTCATGGACTACTCGAGTAGTCCATGACTGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205848.1-931s1c1
Sequence:CCGGGCATCTCAGTGTCTTCGACTTCTCGAGAAGTCGAAGACACTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205848.1-1710s1c1
Sequence:CCGGCCGTCTAAACAGTGTTGTGCACTCGAGTGCACAACACTGTTTAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205848.1-544s1c1
Sequence:CCGGGCATGTCTCCAGTGTAGACTACTCGAGTAGTCTACACTGGAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_205848.1-691s1c1
Sequence:CCGGGATCAACTTCAGCCTACGCTACTCGAGTAGCGTAGGCTGAAGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205848
VALIDATED
SYT6 MISSION shRNA shRNA Plasmid DNA
synaptotagmin VI
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1165s21c1
Sequence:GTACCGGGATGGACATCACAGGCTATTCCTCGAGGAATAGCCTGTGATGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1511s21c1
Sequence:GTACCGGGGAAACCCTCGGTTGTGATTTCTCGAGAAATCACAACCGAGGGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1475s21c1
Sequence:CCGGCACTCCTTGGTGGAGGTAAAGCTCGAGCTTTACCTCCACCAAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-933s21c1
Sequence:CCGGATCTCAGTGTCTTCGACTTTGCTCGAGCAAAGTCGAAGACACTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_205848.2-1037s21c1
Sequence:CCGGATCTGGAAGGATATCCAATATCTCGAGATATTGGATATCCTTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205848.2-3382s21c1
Sequence:CCGGTAGTCTGGTAGTCCTACATTTCTCGAGAAATGTAGGACTACCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-698s21c1
Sequence:CCGGTTCAGCCTACGCTACGATTACCTCGAGGTAATCGTAGCGTAGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1125s21c1
Sequence:GTACCGGGGCTCACCCTCACAGTGATTACTCGAGTAATCACTGTGAGGGTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205848.2-1698s21c1
Sequence:GTACCGGGCACTTGTTCAACCGTCTAAACTCGAGTTTAGACGGTTGAACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-546s21c1
Sequence:GTACCGGATGTCTCCAGTGTAGACTATGCTCGAGCATAGTCTACACTGGAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1263s21c1
Sequence:GTACCGGCTCTCAATCCTGTCTACAATGCTCGAGCATTGTAGACAGGATTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205848.2-1648s21c1
Sequence:GTACCGGATGAGATGTGCAGCCAAATAACTCGAGTTATTTGGCTGCACATCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205848.1-1060s1c1
Sequence:CCGGCACAAGTGAAAGCGTGGACTTCTCGAGAAGTCCACGCTTTCACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205848.1-1164s1c1
Sequence:CCGGCGATGGACATCACAGGCTATTCTCGAGAATAGCCTGTGATGTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205848.1-1333s1c1
Sequence:CCGGGCTCATCTCAGTCATGGACTACTCGAGTAGTCCATGACTGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205848.1-931s1c1
Sequence:CCGGGCATCTCAGTGTCTTCGACTTCTCGAGAAGTCGAAGACACTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205848.1-1710s1c1
Sequence:CCGGCCGTCTAAACAGTGTTGTGCACTCGAGTGCACAACACTGTTTAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205848.1-544s1c1
Sequence:CCGGGCATGTCTCCAGTGTAGACTACTCGAGTAGTCTACACTGGAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_205848.1-691s1c1
Sequence:CCGGGATCAACTTCAGCCTACGCTACTCGAGTAGCGTAGGCTGAAGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205848
VALIDATED
SYT6 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin VI
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1165s21c1
Sequence:GTACCGGGATGGACATCACAGGCTATTCCTCGAGGAATAGCCTGTGATGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1511s21c1
Sequence:GTACCGGGGAAACCCTCGGTTGTGATTTCTCGAGAAATCACAACCGAGGGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1475s21c1
Sequence:CCGGCACTCCTTGGTGGAGGTAAAGCTCGAGCTTTACCTCCACCAAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-933s21c1
Sequence:CCGGATCTCAGTGTCTTCGACTTTGCTCGAGCAAAGTCGAAGACACTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_205848.2-1037s21c1
Sequence:CCGGATCTGGAAGGATATCCAATATCTCGAGATATTGGATATCCTTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205848.2-3382s21c1
Sequence:CCGGTAGTCTGGTAGTCCTACATTTCTCGAGAAATGTAGGACTACCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-698s21c1
Sequence:CCGGTTCAGCCTACGCTACGATTACCTCGAGGTAATCGTAGCGTAGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1125s21c1
Sequence:GTACCGGGGCTCACCCTCACAGTGATTACTCGAGTAATCACTGTGAGGGTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205848.2-1698s21c1
Sequence:GTACCGGGCACTTGTTCAACCGTCTAAACTCGAGTTTAGACGGTTGAACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-546s21c1
Sequence:GTACCGGATGTCTCCAGTGTAGACTATGCTCGAGCATAGTCTACACTGGAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205848.2-1263s21c1
Sequence:GTACCGGCTCTCAATCCTGTCTACAATGCTCGAGCATTGTAGACAGGATTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205848.2-1648s21c1
Sequence:GTACCGGATGAGATGTGCAGCCAAATAACTCGAGTTATTTGGCTGCACATCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205848.1-1060s1c1
Sequence:CCGGCACAAGTGAAAGCGTGGACTTCTCGAGAAGTCCACGCTTTCACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205848.1-1164s1c1
Sequence:CCGGCGATGGACATCACAGGCTATTCTCGAGAATAGCCTGTGATGTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205848.1-1333s1c1
Sequence:CCGGGCTCATCTCAGTCATGGACTACTCGAGTAGTCCATGACTGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205848.1-931s1c1
Sequence:CCGGGCATCTCAGTGTCTTCGACTTCTCGAGAAGTCGAAGACACTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205848.1-1710s1c1
Sequence:CCGGCCGTCTAAACAGTGTTGTGCACTCGAGTGCACAACACTGTTTAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205848.1-544s1c1
Sequence:CCGGGCATGTCTCCAGTGTAGACTACTCGAGTAGTCTACACTGGAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_205848.1-691s1c1
Sequence:CCGGGATCAACTTCAGCCTACGCTACTCGAGTAGCGTAGGCTGAAGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018800
SYT6 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin VI
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018800.3-4008s1c1
Sequence:CCGGCTGAAGCATGAATGGTATAAACTCGAGTTTATACCATTCATGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018800.3-822s21c1
Sequence:CCGGATGAAAGCGAGACGCTGATTGCTCGAGCAATCAGCGTCTCGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018800.3-1432s21c1
Sequence:CCGGGAGCCTGCTCATCTCCGTTATCTCGAGATAACGGAGATGAGCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018800.3-648s21c1
Sequence:CCGGATGTCTCCAGCGTGGACTATGCTCGAGCATAGTCCACGCTGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018800.3-4009s21c1
Sequence:CCGGTGAAGCATGAATGGTATAAATCTCGAGATTTATACCATTCATGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018800.3-276s21c1
Sequence:CCGGTCCTCGCCGTGGTAGTTATTGCTCGAGCAATAACTACCACGGCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018800.2-1448s1c1
Sequence:CCGGGTTATGGACTATGATAGAGTTCTCGAGAACTCTATCATAGTCCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018800.2-1592s1c1
Sequence:CCGGGAGGTAAAGAAATCCTTCAAACTCGAGTTTGAAGGATTTCTTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018800
SYT6 MISSION shRNA shRNA Plasmid DNA
synaptotagmin VI
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018800.3-4008s1c1
Sequence:CCGGCTGAAGCATGAATGGTATAAACTCGAGTTTATACCATTCATGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018800.3-822s21c1
Sequence:CCGGATGAAAGCGAGACGCTGATTGCTCGAGCAATCAGCGTCTCGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018800.3-1432s21c1
Sequence:CCGGGAGCCTGCTCATCTCCGTTATCTCGAGATAACGGAGATGAGCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018800.3-648s21c1
Sequence:CCGGATGTCTCCAGCGTGGACTATGCTCGAGCATAGTCCACGCTGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018800.3-4009s21c1
Sequence:CCGGTGAAGCATGAATGGTATAAATCTCGAGATTTATACCATTCATGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018800.3-276s21c1
Sequence:CCGGTCCTCGCCGTGGTAGTTATTGCTCGAGCAATAACTACCACGGCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018800.2-1448s1c1
Sequence:CCGGGTTATGGACTATGATAGAGTTCTCGAGAACTCTATCATAGTCCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018800.2-1592s1c1
Sequence:CCGGGAGGTAAAGAAATCCTTCAAACTCGAGTTTGAAGGATTTCTTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018800
SYT6 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin VI
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018800.3-4008s1c1
Sequence:CCGGCTGAAGCATGAATGGTATAAACTCGAGTTTATACCATTCATGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018800.3-822s21c1
Sequence:CCGGATGAAAGCGAGACGCTGATTGCTCGAGCAATCAGCGTCTCGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018800.3-1432s21c1
Sequence:CCGGGAGCCTGCTCATCTCCGTTATCTCGAGATAACGGAGATGAGCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018800.3-648s21c1
Sequence:CCGGATGTCTCCAGCGTGGACTATGCTCGAGCATAGTCCACGCTGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018800.3-4009s21c1
Sequence:CCGGTGAAGCATGAATGGTATAAATCTCGAGATTTATACCATTCATGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018800.3-276s21c1
Sequence:CCGGTCCTCGCCGTGGTAGTTATTGCTCGAGCAATAACTACCACGGCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018800.2-1448s1c1
Sequence:CCGGGTTATGGACTATGATAGAGTTCTCGAGAACTCTATCATAGTCCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018800.2-1592s1c1
Sequence:CCGGGAGGTAAAGAAATCCTTCAAACTCGAGTTTGAAGGATTTCTTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks