EMAIL THIS PAGE TO A FRIEND

SYT7

synaptotagmin VII

Synonyms: IPCA-7 IPCA7 PCANAP7 SYT-VII SYTVII
UniProtKB ID: O43581, F5GZU9, Q08AH6
Gene ID:
Human(9066) Summary: This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretion and lysosome exocytosis. In humans, expression of this gene has been associated with prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Mouse(54525) synaptotagmin VII
Rat(59267) synaptotagmin VII
fruit fly(43783) CG2381 gene product from transcript CG2381-RB
chicken(426016) synaptotagmin VII
Horse(100062526) synaptotagmin VII
domestic cat(101084826) synaptotagmin VII
dog(483796) synaptotagmin VII
chicken(101664874) synaptotagmin VII
chicken(101748423) synaptotagmin VII
cow(540850) synaptotagmin VII
sheep(101109661) synaptotagmin VII
naked mole-rat(101702929) synaptotagmin VII
domestic guinea pig(100725286) synaptotagmin VII
170 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200308 Anti-Synaptotagmin 7 (C-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody mouse, human, rat
western blot pricing
SAB4200160 Anti-Synaptotagmin 7 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, mouse
western blot pricing
HPA012869 Anti-SYT7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5200807 Monoclonal Anti-Synaptotagmin-7 - Alkaline Phosphatase antibody produced in mouse clone S275-14, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200808 Monoclonal Anti-Synaptotagmin-7 - Apc antibody produced in mouse clone S275-14, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200799 Monoclonal Anti-Synaptotagmin-7 - Atto 390 antibody produced in mouse clone S275-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200800 Monoclonal Anti-Synaptotagmin-7 - Atto 488 antibody produced in mouse clone S275-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200801 Monoclonal Anti-Synaptotagmin-7 - Atto 565 antibody produced in mouse clone S275-14, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200802 Monoclonal Anti-Synaptotagmin-7 - Atto 594 antibody produced in mouse clone S275-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200803 Monoclonal Anti-Synaptotagmin-7 - Atto 633 antibody produced in mouse clone S275-14, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200804 Monoclonal Anti-Synaptotagmin-7 - Atto 655 antibody produced in mouse clone S275-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200805 Monoclonal Anti-Synaptotagmin-7 - Atto 680 antibody produced in mouse clone S275-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200806 Monoclonal Anti-Synaptotagmin-7 - Atto 700 antibody produced in mouse clone S275-14, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200809 Monoclonal Anti-Synaptotagmin-7 - Biotin antibody produced in mouse clone S275-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200810 Monoclonal Anti-Synaptotagmin-7 - Fitc antibody produced in mouse clone S275-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200811 Monoclonal Anti-Synaptotagmin-7 - Hrp antibody produced in mouse clone S275-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200812 Monoclonal Anti-Synaptotagmin-7 - Pe/Atto 594 antibody produced in mouse clone S275-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200813 Monoclonal Anti-Synaptotagmin-7 - Percp antibody produced in mouse clone S275-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200814 Monoclonal Anti-Synaptotagmin-7 - Rpe antibody produced in mouse clone S275-14, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200815 Monoclonal Anti-Synaptotagmin-7 - Streptavidin antibody produced in mouse clone S275-14, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200798 Monoclonal Anti-Synaptotagmin-7 antibody produced in mouse clone S275-14, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB1412773 Monoclonal Anti-SYT7 antibody produced in mouse clone 4H4, purified immunoglobulin, 0.5 mg/mL human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004200 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004200 Rosetta Predictions human pricing
NM_021659 Rosetta Predictions rat pricing
NM_018801 Rosetta Predictions mouse pricing
NM_173067 Rosetta Predictions mouse pricing
NM_173068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047888 predicted 1704
2 SASI_Hs01_00047889 predicted 840
3 SASI_Hs01_00047891 predicted 1042
4 SASI_Hs01_00047892 predicted 1146
5 SASI_Hs01_00047893 predicted 1699
6 SASI_Hs01_00047894 predicted 395
7 SASI_Hs01_00047895 predicted 1000
8 SASI_Hs01_00047896 predicted 197
9 SASI_Hs01_00047897 predicted 297
10 SASI_Hs02_00337098 predicted 1699
11 SASI_Hs01_00047890 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063891 predicted 1077
2 SASI_Rn01_00063893 predicted 998
3 SASI_Rn01_00063894 predicted 459
4 SASI_Rn01_00063895 predicted 422
5 SASI_Rn01_00063896 predicted 764
6 SASI_Rn01_00063897 predicted 562
7 SASI_Rn02_00262658 predicted 749
8 SASI_Rn01_00063898 predicted 278
9 SASI_Rn01_00063899 predicted 721
10 SASI_Rn01_00063900 predicted 282
11 SASI_Rn01_00063892 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324127 predicted 957
2 SASI_Mm01_00088592 predicted 1261
3 SASI_Mm02_00324128 predicted 1530
4 SASI_Mm02_00324129 predicted 1392
5 SASI_Mm01_00088594 predicted 982
6 SASI_Mm01_00088595 predicted 989
7 SASI_Mm02_00324130 predicted 1429
8 SASI_Mm02_00324131 predicted 1229
9 SASI_Mm02_00324132 predicted 1838
10 SASI_Mm02_00324133 predicted 1431
11 SASI_Mm01_00088591 predicted 612
12 SASI_Mm01_00088593 predicted 450
13 SASI_Mm01_00088596 predicted 577
14 SASI_Mm01_00088597 predicted 493
15 SASI_Mm01_00088598 predicted 573
16 SASI_Mm01_00088599 predicted 604
17 SASI_Mm01_00088600 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345124 predicted 1087
2 SASI_Mm01_00089497 predicted 1389
3 SASI_Mm02_00345125 predicted 1660
4 SASI_Mm02_00345126 predicted 1523
5 SASI_Mm01_00089499 predicted 1116
6 SASI_Mm01_00089500 predicted 1123
7 SASI_Mm02_00345127 predicted 1558
8 SASI_Mm02_00345128 predicted 1365
9 SASI_Mm02_00345129 predicted 1964
10 SASI_Mm02_00345130 predicted 1561
11 SASI_Mm01_00089496 predicted 744
12 SASI_Mm01_00089498 predicted 589
13 SASI_Mm01_00089501 predicted 711
14 SASI_Mm01_00089502 predicted 630
15 SASI_Mm01_00089503 predicted 699
16 SASI_Mm01_00089504 predicted 745
17 SASI_Mm01_00089505 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345131 predicted 1445
2 SASI_Mm01_00078194 predicted 1748
3 SASI_Mm02_00345132 predicted 2021
4 SASI_Mm02_00345133 predicted 1878
5 SASI_Mm01_00078196 predicted 1473
6 SASI_Mm01_00078197 predicted 1481
7 SASI_Mm02_00345134 predicted 1917
8 SASI_Mm02_00345135 predicted 1726
9 SASI_Mm02_00345136 predicted 2323
10 SASI_Mm02_00345137 predicted 1927
11 SASI_Mm01_00078193 predicted 953
12 SASI_Mm01_00078195 predicted 801
13 SASI_Mm01_00078198 predicted 919
14 SASI_Mm01_00078199 predicted 837
15 SASI_Mm01_00078200 predicted 918
16 SASI_Mm01_00078201 predicted 949
17 SASI_Mm01_00078202 predicted 961
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018801
SYT7 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin VII
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-930s1c1
Sequence:CCGGGATGTATAAAGACAAGCGGGTCTCGAGACCCGCTTGTCTTTATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-431s1c1
Sequence:CCGGGCTACAACTTCCAAGAGTCCACTCGAGTGGACTCTTGGAAGTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-1047s1c1
Sequence:CCGGCACGATCATCATCACTGTCATCTCGAGATGACAGTGATGATGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-969s1c1
Sequence:CCGGGACAAAGAAGAGGAACCTGAACTCGAGTTCAGGTTCCTCTTCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-597s1c1
Sequence:CCGGCTGGAATGAGACCTTTCTATTCTCGAGAATAGAAAGGTCTCATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-420s1c1
Sequence:CCGGGTTCAGTGTTGGCTACAACTTCTCGAGAAGTTGTAGCCAACACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-197s1c1
Sequence:CCGGGTGAGAAGAAAGCCATCAAGTCTCGAGACTTGATGGCTTTCTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018801.3-1310s21c1
Sequence:CCGGTGAAGGTGTGGCTGATGTATACTCGAGTATACATCAGCCACACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018801.3-963s21c1
Sequence:CCGGGGTGAAGCGGAAGAATCTAAACTCGAGTTTAGATTCTTCCGCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018801.3-469s21c1
Sequence:CCGGGTCAGCCTTAGCGTCACTATCCTCGAGGATAGTGACGCTAAGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018801.3-1397s21c1
Sequence:CCGGAGTCTTTCGCCTTCGACATACCTCGAGGTATGTCGAAGGCGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018801.3-2078s21c1
Sequence:CCGGGGACACTGAGGATAGTATATACTCGAGTATATACTATCCTCAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018801
SYT7 MISSION shRNA shRNA Plasmid DNA
synaptotagmin VII
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-930s1c1
Sequence:CCGGGATGTATAAAGACAAGCGGGTCTCGAGACCCGCTTGTCTTTATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-431s1c1
Sequence:CCGGGCTACAACTTCCAAGAGTCCACTCGAGTGGACTCTTGGAAGTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-1047s1c1
Sequence:CCGGCACGATCATCATCACTGTCATCTCGAGATGACAGTGATGATGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-969s1c1
Sequence:CCGGGACAAAGAAGAGGAACCTGAACTCGAGTTCAGGTTCCTCTTCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-597s1c1
Sequence:CCGGCTGGAATGAGACCTTTCTATTCTCGAGAATAGAAAGGTCTCATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-420s1c1
Sequence:CCGGGTTCAGTGTTGGCTACAACTTCTCGAGAAGTTGTAGCCAACACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-197s1c1
Sequence:CCGGGTGAGAAGAAAGCCATCAAGTCTCGAGACTTGATGGCTTTCTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018801.3-1310s21c1
Sequence:CCGGTGAAGGTGTGGCTGATGTATACTCGAGTATACATCAGCCACACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018801.3-963s21c1
Sequence:CCGGGGTGAAGCGGAAGAATCTAAACTCGAGTTTAGATTCTTCCGCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018801.3-469s21c1
Sequence:CCGGGTCAGCCTTAGCGTCACTATCCTCGAGGATAGTGACGCTAAGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018801.3-1397s21c1
Sequence:CCGGAGTCTTTCGCCTTCGACATACCTCGAGGTATGTCGAAGGCGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018801.3-2078s21c1
Sequence:CCGGGGACACTGAGGATAGTATATACTCGAGTATATACTATCCTCAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018801
SYT7 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin VII
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-930s1c1
Sequence:CCGGGATGTATAAAGACAAGCGGGTCTCGAGACCCGCTTGTCTTTATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-431s1c1
Sequence:CCGGGCTACAACTTCCAAGAGTCCACTCGAGTGGACTCTTGGAAGTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-1047s1c1
Sequence:CCGGCACGATCATCATCACTGTCATCTCGAGATGACAGTGATGATGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-969s1c1
Sequence:CCGGGACAAAGAAGAGGAACCTGAACTCGAGTTCAGGTTCCTCTTCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-597s1c1
Sequence:CCGGCTGGAATGAGACCTTTCTATTCTCGAGAATAGAAAGGTCTCATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-420s1c1
Sequence:CCGGGTTCAGTGTTGGCTACAACTTCTCGAGAAGTTGTAGCCAACACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018801.1-197s1c1
Sequence:CCGGGTGAGAAGAAAGCCATCAAGTCTCGAGACTTGATGGCTTTCTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018801.3-1310s21c1
Sequence:CCGGTGAAGGTGTGGCTGATGTATACTCGAGTATACATCAGCCACACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018801.3-963s21c1
Sequence:CCGGGGTGAAGCGGAAGAATCTAAACTCGAGTTTAGATTCTTCCGCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018801.3-469s21c1
Sequence:CCGGGTCAGCCTTAGCGTCACTATCCTCGAGGATAGTGACGCTAAGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018801.3-1397s21c1
Sequence:CCGGAGTCTTTCGCCTTCGACATACCTCGAGGTATGTCGAAGGCGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018801.3-2078s21c1
Sequence:CCGGGGACACTGAGGATAGTATATACTCGAGTATATACTATCCTCAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004200
SYT7 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin VII
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004200.2-1705s1c1
Sequence:CCGGCCCTGAATGTCGAGGATAGTACTCGAGTACTATCCTCGACATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004200.2-459s1c1
Sequence:CCGGGCTCACCGTGAAGATCATGAACTCGAGTTCATGATCTTCACGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004200.2-138s1c1
Sequence:CCGGACTGGGCAAACGCTACAAGAACTCGAGTTCTTGTAGCGTTTGCCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004200.2-975s1c1
Sequence:CCGGGACGATGAAGAGGAACCTGAACTCGAGTTCAGGTTCCTCTTCATCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004200.2-861s1c1
Sequence:CCGGGAACATCATCAAAGCCCGGAACTCGAGTTCCGGGCTTTGATGATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004200.2-1262s21c1
Sequence:GTACCGGATCATGCCCTCACCACTTTATCTCGAGATAAAGTGGTGAGGGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-975s21c1
Sequence:CCGGGACGATGAAGAGGAACCTGAACTCGAGTTCAGGTTCCTCTTCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-459s21c1
Sequence:CCGGGCTCACCGTGAAGATCATGAACTCGAGTTCATGATCTTCACGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-1151s21c1
Sequence:GTACCGGAGCACTGGAAGGACATGATTGCTCGAGCAATCATGTCCTTCCAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-869s21c1
Sequence:GTACCGGTCAAAGCCCGGAACCTCAAAGCTCGAGCTTTGAGGTTCCGGGCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004200.2-1705s21c1
Sequence:CCGGCCCTGAATGTCGAGGATAGTACTCGAGTACTATCCTCGACATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-138s21c1
Sequence:CCGGACTGGGCAAACGCTACAAGAACTCGAGTTCTTGTAGCGTTTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004200
SYT7 MISSION shRNA shRNA Plasmid DNA
synaptotagmin VII
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004200.2-1705s1c1
Sequence:CCGGCCCTGAATGTCGAGGATAGTACTCGAGTACTATCCTCGACATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004200.2-459s1c1
Sequence:CCGGGCTCACCGTGAAGATCATGAACTCGAGTTCATGATCTTCACGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004200.2-138s1c1
Sequence:CCGGACTGGGCAAACGCTACAAGAACTCGAGTTCTTGTAGCGTTTGCCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004200.2-975s1c1
Sequence:CCGGGACGATGAAGAGGAACCTGAACTCGAGTTCAGGTTCCTCTTCATCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004200.2-861s1c1
Sequence:CCGGGAACATCATCAAAGCCCGGAACTCGAGTTCCGGGCTTTGATGATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004200.2-1262s21c1
Sequence:GTACCGGATCATGCCCTCACCACTTTATCTCGAGATAAAGTGGTGAGGGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-975s21c1
Sequence:CCGGGACGATGAAGAGGAACCTGAACTCGAGTTCAGGTTCCTCTTCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-459s21c1
Sequence:CCGGGCTCACCGTGAAGATCATGAACTCGAGTTCATGATCTTCACGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-1151s21c1
Sequence:GTACCGGAGCACTGGAAGGACATGATTGCTCGAGCAATCATGTCCTTCCAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-869s21c1
Sequence:GTACCGGTCAAAGCCCGGAACCTCAAAGCTCGAGCTTTGAGGTTCCGGGCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004200.2-1705s21c1
Sequence:CCGGCCCTGAATGTCGAGGATAGTACTCGAGTACTATCCTCGACATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-138s21c1
Sequence:CCGGACTGGGCAAACGCTACAAGAACTCGAGTTCTTGTAGCGTTTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004200
SYT7 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin VII
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004200.2-1705s1c1
Sequence:CCGGCCCTGAATGTCGAGGATAGTACTCGAGTACTATCCTCGACATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004200.2-459s1c1
Sequence:CCGGGCTCACCGTGAAGATCATGAACTCGAGTTCATGATCTTCACGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004200.2-138s1c1
Sequence:CCGGACTGGGCAAACGCTACAAGAACTCGAGTTCTTGTAGCGTTTGCCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004200.2-975s1c1
Sequence:CCGGGACGATGAAGAGGAACCTGAACTCGAGTTCAGGTTCCTCTTCATCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004200.2-861s1c1
Sequence:CCGGGAACATCATCAAAGCCCGGAACTCGAGTTCCGGGCTTTGATGATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004200.2-1262s21c1
Sequence:GTACCGGATCATGCCCTCACCACTTTATCTCGAGATAAAGTGGTGAGGGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-975s21c1
Sequence:CCGGGACGATGAAGAGGAACCTGAACTCGAGTTCAGGTTCCTCTTCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-459s21c1
Sequence:CCGGGCTCACCGTGAAGATCATGAACTCGAGTTCATGATCTTCACGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-1151s21c1
Sequence:GTACCGGAGCACTGGAAGGACATGATTGCTCGAGCAATCATGTCCTTCCAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-869s21c1
Sequence:GTACCGGTCAAAGCCCGGAACCTCAAAGCTCGAGCTTTGAGGTTCCGGGCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004200.2-1705s21c1
Sequence:CCGGCCCTGAATGTCGAGGATAGTACTCGAGTACTATCCTCGACATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004200.2-138s21c1
Sequence:CCGGACTGGGCAAACGCTACAAGAACTCGAGTTCTTGTAGCGTTTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks