EMAIL THIS PAGE TO A FRIEND

SYT8

synaptotagmin VIII

UniProtKB ID: Q8NBV8, A6NFJ4, Q9NSV9
Gene ID:
Human(90019) Summary: Synaptotagmins, such as SYT8, share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains. Some synaptotagmins are involved in synaptic membrane fusion, while others have a more general function in endocytosis. For further information on synaptotagmins, see MIM 185605.[supplied by OMIM, May 2003]
Mouse(55925) synaptotagmin VIII
Rat(60566) synaptotagmin VIII
Zebrafish(570237) synaptotagmin VIII
dog(611547) synaptotagmin VIII
chicken(423095) synaptotagmin VIII
domestic guinea pig(100722809) synaptotagmin VIII
naked mole-rat(101717667) synaptotagmin VIII
cow(613562) synaptotagmin VIII
sheep(101121388) synaptotagmin VIII
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138567 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018802 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018802 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018802 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097081 MISSION® esiRNA esiRNA human SYT8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138567 Rosetta Predictions human pricing
NM_053325 Rosetta Predictions rat pricing
NM_018802 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181191 predicted 665
2 SASI_Hs01_00181192 predicted 423
3 SASI_Hs01_00181193 predicted 1070
4 SASI_Hs01_00181194 predicted 216
5 SASI_Hs01_00181195 predicted 874
6 SASI_Hs01_00181196 predicted 950
7 SASI_Hs01_00181197 predicted 1137
8 SASI_Hs01_00181198 predicted 502
9 SASI_Hs01_00181199 predicted 216
10 SASI_Hs01_00181200 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115694 predicted 875
2 SASI_Rn01_00115695 predicted 823
3 SASI_Rn01_00115696 predicted 582
4 SASI_Rn01_00115697 predicted 220
5 SASI_Rn01_00115698 predicted 641
6 SASI_Rn02_00265757 predicted 812
7 SASI_Rn01_00115699 predicted 828
8 SASI_Rn01_00115700 predicted 233
9 SASI_Rn02_00265758 predicted 569
10 SASI_Rn02_00265759 predicted 472
11 SASI_Rn01_00115701 predicted 842
12 SASI_Rn01_00115702 predicted 278
13 SASI_Rn01_00115703 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018802 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128418 predicted 563
2 SASI_Mm01_00128419 predicted 437
3 SASI_Mm01_00128420 predicted 1048
4 SASI_Mm01_00128421 predicted 1221
5 SASI_Mm01_00128422 predicted 1030
6 SASI_Mm01_00128423 predicted 624
7 SASI_Mm01_00128424 predicted 1041
8 SASI_Mm01_00128425 predicted 494
9 SASI_Mm01_00128426 predicted 1147
10 SASI_Mm01_00128427 predicted 951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138567
SYT8 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin VIII
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138567.3-427s21c1
Sequence:CCGGTGGTGCAACCTGATGTGGATGCTCGAGCATCCACATCAGGTTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138567.3-953s21c1
Sequence:CCGGACTTGCAGAGCCCTACGTGAACTCGAGTTCACGTAGGGCTCTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.3-220s1c1
Sequence:CCGGCAGCTATACCTGGGCTTATTCCTCGAGGAATAAGCCCAGGTATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.3-496s1c1
Sequence:CCGGTCTCCCTGGAGTTCGACTTTGCTCGAGCAAAGTCGAACTCCAGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138567.3-792s21c1
Sequence:CCGGACCGTGGATCTGCAGCATGTTCTCGAGAACATGCTGCAGATCCACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138567.3-509s21c1
Sequence:CCGGCGACTTTGGAAGCCAGGAGATCTCGAGATCTCCTGGCTTCCAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.2-723s1c1
Sequence:CCGGCGGACACAGACATGAGACAAACTCGAGTTTGTCTCATGTCTGTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.2-1244s1c1
Sequence:CCGGGAGGAAGTGGAAGAAGAGAAACTCGAGTTTCTCTTCTTCCACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.2-1238s1c1
Sequence:CCGGGAACCAGAGGAAGTGGAAGAACTCGAGTTCTTCCACTTCCTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138567
SYT8 MISSION shRNA shRNA Plasmid DNA
synaptotagmin VIII
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138567.3-427s21c1
Sequence:CCGGTGGTGCAACCTGATGTGGATGCTCGAGCATCCACATCAGGTTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138567.3-953s21c1
Sequence:CCGGACTTGCAGAGCCCTACGTGAACTCGAGTTCACGTAGGGCTCTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.3-220s1c1
Sequence:CCGGCAGCTATACCTGGGCTTATTCCTCGAGGAATAAGCCCAGGTATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.3-496s1c1
Sequence:CCGGTCTCCCTGGAGTTCGACTTTGCTCGAGCAAAGTCGAACTCCAGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138567.3-792s21c1
Sequence:CCGGACCGTGGATCTGCAGCATGTTCTCGAGAACATGCTGCAGATCCACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138567.3-509s21c1
Sequence:CCGGCGACTTTGGAAGCCAGGAGATCTCGAGATCTCCTGGCTTCCAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.2-723s1c1
Sequence:CCGGCGGACACAGACATGAGACAAACTCGAGTTTGTCTCATGTCTGTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.2-1244s1c1
Sequence:CCGGGAGGAAGTGGAAGAAGAGAAACTCGAGTTTCTCTTCTTCCACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.2-1238s1c1
Sequence:CCGGGAACCAGAGGAAGTGGAAGAACTCGAGTTCTTCCACTTCCTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138567
SYT8 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin VIII
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138567.3-427s21c1
Sequence:CCGGTGGTGCAACCTGATGTGGATGCTCGAGCATCCACATCAGGTTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138567.3-953s21c1
Sequence:CCGGACTTGCAGAGCCCTACGTGAACTCGAGTTCACGTAGGGCTCTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.3-220s1c1
Sequence:CCGGCAGCTATACCTGGGCTTATTCCTCGAGGAATAAGCCCAGGTATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.3-496s1c1
Sequence:CCGGTCTCCCTGGAGTTCGACTTTGCTCGAGCAAAGTCGAACTCCAGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138567.3-792s21c1
Sequence:CCGGACCGTGGATCTGCAGCATGTTCTCGAGAACATGCTGCAGATCCACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138567.3-509s21c1
Sequence:CCGGCGACTTTGGAAGCCAGGAGATCTCGAGATCTCCTGGCTTCCAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.2-723s1c1
Sequence:CCGGCGGACACAGACATGAGACAAACTCGAGTTTGTCTCATGTCTGTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.2-1244s1c1
Sequence:CCGGGAGGAAGTGGAAGAAGAGAAACTCGAGTTTCTCTTCTTCCACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138567.2-1238s1c1
Sequence:CCGGGAACCAGAGGAAGTGGAAGAACTCGAGTTCTTCCACTTCCTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018802
SYT8 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin VIII
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018802.4-570s21c1
Sequence:GTACCGGTCCTGCTGTCACTAGAGTATGCTCGAGCATACTCTAGTGACAGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018802.4-594s21c1
Sequence:GTACCGGTTGGAAGCCAGGAGATTAGAGCTCGAGCTCTAATCTCCTGGCTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018802.4-402s21c1
Sequence:GTACCGGTCTGTGTCATCTGTTGCTATTCTCGAGAATAGCAACAGATGACACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018802.4-695s21c1
Sequence:GTACCGGGGGAGAAGACATGAGACAAAGCTCGAGCTTTGTCTCATGTCTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-1061s1c1
Sequence:CCGGGCTTATGTTAAACCAGAGAAACTCGAGTTTCTCTGGTTTAACATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-575s1c1
Sequence:CCGGGCTGTCACTAGAGTATGATTTCTCGAGAAATCATACTCTAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-379s1c1
Sequence:CCGGGAGTCCTCTTAGTCTCCTGTTCTCGAGAACAGGAGACTAAGAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-1344s1c1
Sequence:CCGGCCCAGGGAAGTGGATCGTGTTCTCGAGAACACGATCCACTTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-1102s1c1
Sequence:CCGGCCTCCAAGAAAGGCACGACTACTCGAGTAGTCGTGCCTTTCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018802
SYT8 MISSION shRNA shRNA Plasmid DNA
synaptotagmin VIII
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018802.4-570s21c1
Sequence:GTACCGGTCCTGCTGTCACTAGAGTATGCTCGAGCATACTCTAGTGACAGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018802.4-594s21c1
Sequence:GTACCGGTTGGAAGCCAGGAGATTAGAGCTCGAGCTCTAATCTCCTGGCTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018802.4-402s21c1
Sequence:GTACCGGTCTGTGTCATCTGTTGCTATTCTCGAGAATAGCAACAGATGACACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018802.4-695s21c1
Sequence:GTACCGGGGGAGAAGACATGAGACAAAGCTCGAGCTTTGTCTCATGTCTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-1061s1c1
Sequence:CCGGGCTTATGTTAAACCAGAGAAACTCGAGTTTCTCTGGTTTAACATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-575s1c1
Sequence:CCGGGCTGTCACTAGAGTATGATTTCTCGAGAAATCATACTCTAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-379s1c1
Sequence:CCGGGAGTCCTCTTAGTCTCCTGTTCTCGAGAACAGGAGACTAAGAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-1344s1c1
Sequence:CCGGCCCAGGGAAGTGGATCGTGTTCTCGAGAACACGATCCACTTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-1102s1c1
Sequence:CCGGCCTCCAAGAAAGGCACGACTACTCGAGTAGTCGTGCCTTTCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018802
SYT8 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin VIII
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018802.4-570s21c1
Sequence:GTACCGGTCCTGCTGTCACTAGAGTATGCTCGAGCATACTCTAGTGACAGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018802.4-594s21c1
Sequence:GTACCGGTTGGAAGCCAGGAGATTAGAGCTCGAGCTCTAATCTCCTGGCTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018802.4-402s21c1
Sequence:GTACCGGTCTGTGTCATCTGTTGCTATTCTCGAGAATAGCAACAGATGACACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018802.4-695s21c1
Sequence:GTACCGGGGGAGAAGACATGAGACAAAGCTCGAGCTTTGTCTCATGTCTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-1061s1c1
Sequence:CCGGGCTTATGTTAAACCAGAGAAACTCGAGTTTCTCTGGTTTAACATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-575s1c1
Sequence:CCGGGCTGTCACTAGAGTATGATTTCTCGAGAAATCATACTCTAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-379s1c1
Sequence:CCGGGAGTCCTCTTAGTCTCCTGTTCTCGAGAACAGGAGACTAAGAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-1344s1c1
Sequence:CCGGCCCAGGGAAGTGGATCGTGTTCTCGAGAACACGATCCACTTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018802.2-1102s1c1
Sequence:CCGGCCTCCAAGAAAGGCACGACTACTCGAGTAGTCGTGCCTTTCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks