EMAIL THIS PAGE TO A FRIEND

SYT9

synaptotagmin IX

UniProtKB ID: Q86SS6
Gene ID:
Mouse(60510) synaptotagmin IX
Rat(60564) synaptotagmin IX
cow(536969) synaptotagmin IX
sheep(101106543) synaptotagmin IX
naked mole-rat(101711627) synaptotagmin IX
Domestic Rabbit(100343696) synaptotagmin IX
chicken(423026) synaptotagmin IX
dog(485365) synaptotagmin IX
Horse(100070556) synaptotagmin IX
domestic cat(101087096) synaptotagmin IX
215 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175733 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175733 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175733 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175733 Rosetta Predictions human pricing
NM_053324 Rosetta Predictions rat pricing
NM_021889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195243 predicted 1263
2 SASI_Hs01_00195244 predicted 1757
3 SASI_Hs01_00195247 predicted 1530
4 SASI_Hs01_00195248 predicted 1581
5 SASI_Hs01_00195249 predicted 1698
6 SASI_Hs01_00195251 predicted 1493
7 SASI_Hs01_00195252 predicted 814
8 SASI_Hs02_00369074 predicted 1531
9 SASI_Hs02_00369075 predicted 1401
10 SASI_Hs02_00369076 predicted 927
11 SASI_Hs01_00195245 predicted 959
12 SASI_Hs01_00195246 predicted 1365
13 SASI_Hs01_00195250 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063560 predicted 599
2 SASI_Rn01_00063561 predicted 1165
3 SASI_Rn01_00063562 predicted 1231
4 SASI_Rn01_00063563 predicted 657
5 SASI_Rn01_00063564 predicted 586
6 SASI_Rn01_00063565 predicted 299
7 SASI_Rn02_00265756 predicted 1120
8 SASI_Rn01_00063566 predicted 1136
9 SASI_Rn01_00063567 predicted 1024
10 SASI_Rn01_00063568 predicted 563
11 SASI_Rn01_00063569 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170256 predicted 1383
2 SASI_Mm01_00170257 predicted 1059
3 SASI_Mm01_00170258 predicted 368
4 SASI_Mm01_00170259 predicted 1368
5 SASI_Mm01_00170261 predicted 489
6 SASI_Mm01_00170262 predicted 1736
7 SASI_Mm01_00170263 predicted 1445
8 SASI_Mm02_00326454 predicted 1674
9 SASI_Mm02_00326455 predicted 797
10 SASI_Mm01_00170265 predicted 1350
11 SASI_Mm01_00170260 predicted 821
12 SASI_Mm01_00170264 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175733
SYT9 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin IX
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-440s1c1
Sequence:CCGGGCGTGTCTCTCTTCGTATCTTCTCGAGAAGATACGAAGAGAGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-1644s1c1
Sequence:CCGGCTGGAGTGAAATGTTGTCATACTCGAGTATGACAACATTTCACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-1486s1c1
Sequence:CCGGCCTGTTTACAACGAAGCCATACTCGAGTATGGCTTCGTTGTAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-1542s1c1
Sequence:CCGGCCACTTGTCCATAGCAGTCATCTCGAGATGACTGCTATGGACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-731s1c1
Sequence:CCGGCCCGGCATAATTCAATCCGAACTCGAGTTCGGATTGAATTATGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1340s21c1
Sequence:GTACCGGGGCTGACCATTACCATTATAACTCGAGTTATAATGGTAATGGTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1106s21c1
Sequence:GTACCGGTATTTCCGGTTCCCTACAATGCTCGAGCATTGTAGGGAACCGGAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1009s21c1
Sequence:GTACCGGCCTTATGTCAAGATCTATTTGCTCGAGCAAATAGATCTTGACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1148s21c1
Sequence:GTACCGGACTTCTCTGTGTACGACTTTGCTCGAGCAAAGTCGTACACAGAGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1493s21c1
Sequence:GTACCGGACAACGAAGCCATAGTCTTTGCTCGAGCAAAGACTATGGCTTCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175733.2-2060s21c1
Sequence:GTACCGGATCTGCCCTGGAAATCGTTATCTCGAGATAACGATTTCCAGGGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175733.2-2175s21c1
Sequence:GTACCGGATGACTACCTTTGAGCTAATGCTCGAGCATTAGCTCAAAGGTAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175733
SYT9 MISSION shRNA shRNA Plasmid DNA
synaptotagmin IX
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-440s1c1
Sequence:CCGGGCGTGTCTCTCTTCGTATCTTCTCGAGAAGATACGAAGAGAGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-1644s1c1
Sequence:CCGGCTGGAGTGAAATGTTGTCATACTCGAGTATGACAACATTTCACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-1486s1c1
Sequence:CCGGCCTGTTTACAACGAAGCCATACTCGAGTATGGCTTCGTTGTAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-1542s1c1
Sequence:CCGGCCACTTGTCCATAGCAGTCATCTCGAGATGACTGCTATGGACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-731s1c1
Sequence:CCGGCCCGGCATAATTCAATCCGAACTCGAGTTCGGATTGAATTATGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1340s21c1
Sequence:GTACCGGGGCTGACCATTACCATTATAACTCGAGTTATAATGGTAATGGTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1106s21c1
Sequence:GTACCGGTATTTCCGGTTCCCTACAATGCTCGAGCATTGTAGGGAACCGGAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1009s21c1
Sequence:GTACCGGCCTTATGTCAAGATCTATTTGCTCGAGCAAATAGATCTTGACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1148s21c1
Sequence:GTACCGGACTTCTCTGTGTACGACTTTGCTCGAGCAAAGTCGTACACAGAGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1493s21c1
Sequence:GTACCGGACAACGAAGCCATAGTCTTTGCTCGAGCAAAGACTATGGCTTCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175733.2-2060s21c1
Sequence:GTACCGGATCTGCCCTGGAAATCGTTATCTCGAGATAACGATTTCCAGGGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175733.2-2175s21c1
Sequence:GTACCGGATGACTACCTTTGAGCTAATGCTCGAGCATTAGCTCAAAGGTAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175733
SYT9 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin IX
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-440s1c1
Sequence:CCGGGCGTGTCTCTCTTCGTATCTTCTCGAGAAGATACGAAGAGAGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-1644s1c1
Sequence:CCGGCTGGAGTGAAATGTTGTCATACTCGAGTATGACAACATTTCACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-1486s1c1
Sequence:CCGGCCTGTTTACAACGAAGCCATACTCGAGTATGGCTTCGTTGTAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-1542s1c1
Sequence:CCGGCCACTTGTCCATAGCAGTCATCTCGAGATGACTGCTATGGACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175733.2-731s1c1
Sequence:CCGGCCCGGCATAATTCAATCCGAACTCGAGTTCGGATTGAATTATGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1340s21c1
Sequence:GTACCGGGGCTGACCATTACCATTATAACTCGAGTTATAATGGTAATGGTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1106s21c1
Sequence:GTACCGGTATTTCCGGTTCCCTACAATGCTCGAGCATTGTAGGGAACCGGAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1009s21c1
Sequence:GTACCGGCCTTATGTCAAGATCTATTTGCTCGAGCAAATAGATCTTGACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1148s21c1
Sequence:GTACCGGACTTCTCTGTGTACGACTTTGCTCGAGCAAAGTCGTACACAGAGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175733.2-1493s21c1
Sequence:GTACCGGACAACGAAGCCATAGTCTTTGCTCGAGCAAAGACTATGGCTTCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175733.2-2060s21c1
Sequence:GTACCGGATCTGCCCTGGAAATCGTTATCTCGAGATAACGATTTCCAGGGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175733.2-2175s21c1
Sequence:GTACCGGATGACTACCTTTGAGCTAATGCTCGAGCATTAGCTCAAAGGTAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021889
SYT9 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin IX
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021889.2-3407s1c1
Sequence:CCGGGCCTAGAAGAATGGTCCCAAACTCGAGTTTGGGACCATTCTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021889.2-787s1c1
Sequence:CCGGGCTGACTGGGATTGGTAGAATCTCGAGATTCTACCAATCCCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021889.2-922s1c1
Sequence:CCGGGCTCATTGTGAAGATCCACAACTCGAGTTGTGGATCTTCACAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-1243s21c1
Sequence:GTACCGGGAGTATGTCACCAACGATAATCTCGAGATTATCGTTGGTGACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-1674s21c1
Sequence:GTACCGGGATGGAGAAACGATGACTATGCTCGAGCATAGTCATCGTTTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-932s21c1
Sequence:GTACCGGAGATCCACAAAGCCGTCAATCCTCGAGGATTGACGGCTTTGTGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-875s21c1
Sequence:GTACCGGGCGGGAAACTGAACTTCATTTCTCGAGAAATGAAGTTCAGTTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-291s21c1
Sequence:GTACCGGGCACGACAGCTGCCAAGATTTCTCGAGAAATCTTGGCAGCTGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-1441s21c1
Sequence:GTACCGGACCAAGAGGAACACGCTTAATCTCGAGATTAAGCGTGTTCCTCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021889.4-1726s21c1
Sequence:GTACCGGTCGGACAACCATGTAACAAAGCTCGAGCTTTGTTACATGGTTGTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-737s21c1
Sequence:GTACCGGACCTGTCGAACCCGGACTTTACTCGAGTAAAGTCCGGGTTCGACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-908s21c1
Sequence:GTACCGGGCGACTTGGAACAGCTCATTGCTCGAGCAATGAGCTGTTCCAAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021889
SYT9 MISSION shRNA shRNA Plasmid DNA
synaptotagmin IX
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021889.2-3407s1c1
Sequence:CCGGGCCTAGAAGAATGGTCCCAAACTCGAGTTTGGGACCATTCTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021889.2-787s1c1
Sequence:CCGGGCTGACTGGGATTGGTAGAATCTCGAGATTCTACCAATCCCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021889.2-922s1c1
Sequence:CCGGGCTCATTGTGAAGATCCACAACTCGAGTTGTGGATCTTCACAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-1243s21c1
Sequence:GTACCGGGAGTATGTCACCAACGATAATCTCGAGATTATCGTTGGTGACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-1674s21c1
Sequence:GTACCGGGATGGAGAAACGATGACTATGCTCGAGCATAGTCATCGTTTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-932s21c1
Sequence:GTACCGGAGATCCACAAAGCCGTCAATCCTCGAGGATTGACGGCTTTGTGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-875s21c1
Sequence:GTACCGGGCGGGAAACTGAACTTCATTTCTCGAGAAATGAAGTTCAGTTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-291s21c1
Sequence:GTACCGGGCACGACAGCTGCCAAGATTTCTCGAGAAATCTTGGCAGCTGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-1441s21c1
Sequence:GTACCGGACCAAGAGGAACACGCTTAATCTCGAGATTAAGCGTGTTCCTCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021889.4-1726s21c1
Sequence:GTACCGGTCGGACAACCATGTAACAAAGCTCGAGCTTTGTTACATGGTTGTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-737s21c1
Sequence:GTACCGGACCTGTCGAACCCGGACTTTACTCGAGTAAAGTCCGGGTTCGACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-908s21c1
Sequence:GTACCGGGCGACTTGGAACAGCTCATTGCTCGAGCAATGAGCTGTTCCAAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021889
SYT9 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin IX
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021889.2-3407s1c1
Sequence:CCGGGCCTAGAAGAATGGTCCCAAACTCGAGTTTGGGACCATTCTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021889.2-787s1c1
Sequence:CCGGGCTGACTGGGATTGGTAGAATCTCGAGATTCTACCAATCCCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021889.2-922s1c1
Sequence:CCGGGCTCATTGTGAAGATCCACAACTCGAGTTGTGGATCTTCACAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-1243s21c1
Sequence:GTACCGGGAGTATGTCACCAACGATAATCTCGAGATTATCGTTGGTGACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-1674s21c1
Sequence:GTACCGGGATGGAGAAACGATGACTATGCTCGAGCATAGTCATCGTTTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-932s21c1
Sequence:GTACCGGAGATCCACAAAGCCGTCAATCCTCGAGGATTGACGGCTTTGTGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-875s21c1
Sequence:GTACCGGGCGGGAAACTGAACTTCATTTCTCGAGAAATGAAGTTCAGTTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-291s21c1
Sequence:GTACCGGGCACGACAGCTGCCAAGATTTCTCGAGAAATCTTGGCAGCTGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-1441s21c1
Sequence:GTACCGGACCAAGAGGAACACGCTTAATCTCGAGATTAAGCGTGTTCCTCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021889.4-1726s21c1
Sequence:GTACCGGTCGGACAACCATGTAACAAAGCTCGAGCTTTGTTACATGGTTGTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-737s21c1
Sequence:GTACCGGACCTGTCGAACCCGGACTTTACTCGAGTAAAGTCCGGGTTCGACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021889.4-908s21c1
Sequence:GTACCGGGCGACTTGGAACAGCTCATTGCTCGAGCAATGAGCTGTTCCAAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks