EMAIL THIS PAGE TO A FRIEND

SYTL1

synaptotagmin-like 1

Synonyms: JFC1 SLP1
UniProtKB ID: Q8IYJ3, Q5SSC9, Q96BB6, Q96GU6, Q96S89, Q96SI0
Gene ID:
Mouse(269589) synaptotagmin-like 1
Rat(297872) synaptotagmin-like 1
chicken(771987) synaptotagmin-like 1
dog(487346) synaptotagmin-like 1
domestic cat(101089534) synaptotagmin-like 1
Horse(100070941) synaptotagmin-like 1
domestic guinea pig(100712651) synaptotagmin-like 1
Domestic Rabbit(100343322) synaptotagmin-like 1
naked mole-rat(101697986) synaptotagmin-like 1
cow(527641) synaptotagmin-like 1
sheep(101113996) synaptotagmin-like 1
Gene Class: ATPase
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0246 AQUA Peptide ILTGDWFQEA[R] cow, dog, human, mouse, rat pricing
AQ0247 AQUA Peptide VLSLSVWH[R] cow, dog, human, mouse, rat pricing
AQ0204 AQUA Peptide LPDDS[R] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032872 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032872 Rosetta Predictions human pricing
NM_001025651 Rosetta Predictions rat pricing
NM_031393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067148 predicted 475
2 SASI_Hs01_00067149 predicted 448
3 SASI_Hs01_00067150 predicted 1440
4 SASI_Hs01_00067151 predicted 474
5 SASI_Hs01_00067152 predicted 289
6 SASI_Hs01_00067153 predicted 657
7 SASI_Hs01_00067154 predicted 1558
8 SASI_Hs01_00067155 predicted 1465
9 SASI_Hs01_00067156 predicted 255
10 SASI_Hs01_00067157 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050096 predicted 1807
2 SASI_Rn01_00050097 predicted 554
3 SASI_Rn01_00050098 predicted 1516
4 SASI_Rn01_00050099 predicted 1358
5 SASI_Rn01_00050100 predicted 566
6 SASI_Rn01_00050101 predicted 821
7 SASI_Rn01_00050102 predicted 1769
8 SASI_Rn01_00050104 predicted 710
9 SASI_Rn02_00203224 predicted 1053
10 SASI_Rn02_00203225 predicted 1064
11 SASI_Rn01_00050103 predicted 1536
12 SASI_Rn01_00050105 predicted 1498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337141 predicted 603
2 SASI_Mm01_00154236 predicted 1531
3 SASI_Mm01_00154240 predicted 877
4 SASI_Mm01_00154237 predicted 584
5 SASI_Mm01_00154239 predicted 1218
6 SASI_Mm01_00154241 predicted 991
7 SASI_Mm01_00154242 predicted 1124
8 SASI_Mm01_00154243 predicted 1051
9 SASI_Mm02_00337142 predicted 1235
10 SASI_Mm02_00337143 predicted 1074
11 SASI_Mm01_00154234 predicted 1332
12 SASI_Mm01_00154235 predicted 245
13 SASI_Mm01_00154238 predicted 582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032872
VALIDATED
SYTL1 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin-like 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1066s21c1
Sequence:GTACCGGATAAGCAGAGCAAGCGCAAGACTCGAGTCTTGCGCTTGCTCTGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-464s21c1
Sequence:CCGGTGACCTTGTCCGAGCGTCTATCTCGAGATAGACGCTCGGACAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1120s21c1
Sequence:CCGGTCAACGAGACTCTCCGGTACTCTCGAGAGTACCGGAGAGTCTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1213s21c1
Sequence:CCGGACATCTTTCTGGGCGAAGTTGCTCGAGCAACTTCGCCCAGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1088s21c1
Sequence:CCGGGGCGGTGAAGAAACGGAATCTCTCGAGAGATTCCGTTTCTTCACCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1454s21c1
Sequence:CCGGCCTGGACACTTACGTACAATGCTCGAGCATTGTACGTAAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_032872.1-1541s1c1
Sequence:CCGGCCCTGTGTTCAATCACACCATCTCGAGATGGTGTGATTGAACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_032872.1-774s1c1
Sequence:CCGGGCGTCCCAGATCCTGGAGAATCTCGAGATTCTCCAGGATCTGGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_032872.1-1453s1c1
Sequence:CCGGCCCTGGACACTTACGTACAATCTCGAGATTGTACGTAAGTGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032872.1-1058s1c1
Sequence:CCGGCCTCCCGGATAAGCAGAGCAACTCGAGTTGCTCTGCTTATCCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032872.1-543s1c1
Sequence:CCGGGCTGCTGTGAAAGAGAAGGAACTCGAGTTCCTTCTCTTTCACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032872
VALIDATED
SYTL1 MISSION shRNA shRNA Plasmid DNA
synaptotagmin-like 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1066s21c1
Sequence:GTACCGGATAAGCAGAGCAAGCGCAAGACTCGAGTCTTGCGCTTGCTCTGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-464s21c1
Sequence:CCGGTGACCTTGTCCGAGCGTCTATCTCGAGATAGACGCTCGGACAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1120s21c1
Sequence:CCGGTCAACGAGACTCTCCGGTACTCTCGAGAGTACCGGAGAGTCTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1213s21c1
Sequence:CCGGACATCTTTCTGGGCGAAGTTGCTCGAGCAACTTCGCCCAGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1088s21c1
Sequence:CCGGGGCGGTGAAGAAACGGAATCTCTCGAGAGATTCCGTTTCTTCACCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1454s21c1
Sequence:CCGGCCTGGACACTTACGTACAATGCTCGAGCATTGTACGTAAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_032872.1-1541s1c1
Sequence:CCGGCCCTGTGTTCAATCACACCATCTCGAGATGGTGTGATTGAACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_032872.1-774s1c1
Sequence:CCGGGCGTCCCAGATCCTGGAGAATCTCGAGATTCTCCAGGATCTGGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_032872.1-1453s1c1
Sequence:CCGGCCCTGGACACTTACGTACAATCTCGAGATTGTACGTAAGTGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032872.1-1058s1c1
Sequence:CCGGCCTCCCGGATAAGCAGAGCAACTCGAGTTGCTCTGCTTATCCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032872.1-543s1c1
Sequence:CCGGGCTGCTGTGAAAGAGAAGGAACTCGAGTTCCTTCTCTTTCACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032872
VALIDATED
SYTL1 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin-like 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1066s21c1
Sequence:GTACCGGATAAGCAGAGCAAGCGCAAGACTCGAGTCTTGCGCTTGCTCTGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-464s21c1
Sequence:CCGGTGACCTTGTCCGAGCGTCTATCTCGAGATAGACGCTCGGACAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1120s21c1
Sequence:CCGGTCAACGAGACTCTCCGGTACTCTCGAGAGTACCGGAGAGTCTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1213s21c1
Sequence:CCGGACATCTTTCTGGGCGAAGTTGCTCGAGCAACTTCGCCCAGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1088s21c1
Sequence:CCGGGGCGGTGAAGAAACGGAATCTCTCGAGAGATTCCGTTTCTTCACCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032872.1-1454s21c1
Sequence:CCGGCCTGGACACTTACGTACAATGCTCGAGCATTGTACGTAAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_032872.1-1541s1c1
Sequence:CCGGCCCTGTGTTCAATCACACCATCTCGAGATGGTGTGATTGAACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_032872.1-774s1c1
Sequence:CCGGGCGTCCCAGATCCTGGAGAATCTCGAGATTCTCCAGGATCTGGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_032872.1-1453s1c1
Sequence:CCGGCCCTGGACACTTACGTACAATCTCGAGATTGTACGTAAGTGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032872.1-1058s1c1
Sequence:CCGGCCTCCCGGATAAGCAGAGCAACTCGAGTTGCTCTGCTTATCCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032872.1-543s1c1
Sequence:CCGGGCTGCTGTGAAAGAGAAGGAACTCGAGTTCCTTCTCTTTCACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031393
SYTL1 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031393.2-1126s21c1
Sequence:CCGGACGGAATCTGAACCCGATCTTCTCGAGAAGATCGGGTTCAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031393.2-1424s21c1
Sequence:CCGGGAGTTACACTTCTGGGTAAAGCTCGAGCTTTACCCAGAAGTGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031393.2-592s21c1
Sequence:CCGGTGAGACCCAAGGGCCTGATTTCTCGAGAAATCAGGCCCTTGGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031393.2-1476s21c1
Sequence:CCGGGATCCCTGGACACTTACATTCCTCGAGGAATGTAAGTGTCCAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-1455s1c1
Sequence:CCGGCCCTGGACACTTACATTCAATCTCGAGATTGAATGTAAGTGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-595s1c1
Sequence:CCGGCTCACCATATGTACCCTCAAACTCGAGTTTGAGGGTACATATGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-424s1c1
Sequence:CCGGCCGGGCTTCTATCCGAAGGAACTCGAGTTCCTTCGGATAGAAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-1078s1c1
Sequence:CCGGCAAGCGTAAGACGTCAGTGAACTCGAGTTCACTGACGTCTTACGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-594s1c1
Sequence:CCGGCCTCACCATATGTACCCTCAACTCGAGTTGAGGGTACATATGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031393
SYTL1 MISSION shRNA shRNA Plasmid DNA
synaptotagmin-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031393.2-1126s21c1
Sequence:CCGGACGGAATCTGAACCCGATCTTCTCGAGAAGATCGGGTTCAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031393.2-1424s21c1
Sequence:CCGGGAGTTACACTTCTGGGTAAAGCTCGAGCTTTACCCAGAAGTGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031393.2-592s21c1
Sequence:CCGGTGAGACCCAAGGGCCTGATTTCTCGAGAAATCAGGCCCTTGGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031393.2-1476s21c1
Sequence:CCGGGATCCCTGGACACTTACATTCCTCGAGGAATGTAAGTGTCCAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-1455s1c1
Sequence:CCGGCCCTGGACACTTACATTCAATCTCGAGATTGAATGTAAGTGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-595s1c1
Sequence:CCGGCTCACCATATGTACCCTCAAACTCGAGTTTGAGGGTACATATGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-424s1c1
Sequence:CCGGCCGGGCTTCTATCCGAAGGAACTCGAGTTCCTTCGGATAGAAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-1078s1c1
Sequence:CCGGCAAGCGTAAGACGTCAGTGAACTCGAGTTCACTGACGTCTTACGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-594s1c1
Sequence:CCGGCCTCACCATATGTACCCTCAACTCGAGTTGAGGGTACATATGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031393
SYTL1 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031393.2-1126s21c1
Sequence:CCGGACGGAATCTGAACCCGATCTTCTCGAGAAGATCGGGTTCAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031393.2-1424s21c1
Sequence:CCGGGAGTTACACTTCTGGGTAAAGCTCGAGCTTTACCCAGAAGTGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031393.2-592s21c1
Sequence:CCGGTGAGACCCAAGGGCCTGATTTCTCGAGAAATCAGGCCCTTGGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031393.2-1476s21c1
Sequence:CCGGGATCCCTGGACACTTACATTCCTCGAGGAATGTAAGTGTCCAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-1455s1c1
Sequence:CCGGCCCTGGACACTTACATTCAATCTCGAGATTGAATGTAAGTGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-595s1c1
Sequence:CCGGCTCACCATATGTACCCTCAAACTCGAGTTTGAGGGTACATATGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-424s1c1
Sequence:CCGGCCGGGCTTCTATCCGAAGGAACTCGAGTTCCTTCGGATAGAAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-1078s1c1
Sequence:CCGGCAAGCGTAAGACGTCAGTGAACTCGAGTTCACTGACGTCTTACGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031393.1-594s1c1
Sequence:CCGGCCTCACCATATGTACCCTCAACTCGAGTTGAGGGTACATATGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks