EMAIL THIS PAGE TO A FRIEND

SYTL2

synaptotagmin-like 2

Synonyms: CHR11SYT EXO4 SGA72M SLP2 SLP2A
Gene ID:
Human(54843) Summary: The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jun 2009]
Mouse(83671) synaptotagmin-like 2
Rat(361604) synaptotagmin-like 2
cow(614406) synaptotagmin-like 2
sheep(101103681) synaptotagmin-like 2
naked mole-rat(101708191) synaptotagmin-like 2
Domestic Rabbit(100344288) synaptotagmin-like 2
domestic guinea pig(100732096) synaptotagmin-like 2
chicken(426394) synaptotagmin-like 2
dog(485154) synaptotagmin-like 2
Horse(100050854) synaptotagmin-like 2
domestic cat(101095914) synaptotagmin-like 2
151 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032379 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032379 Rosetta Predictions human pricing
NM_032943 Rosetta Predictions human pricing
NM_206927 Rosetta Predictions human pricing
NM_206928 Rosetta Predictions human pricing
NM_206929 Rosetta Predictions human pricing
NM_206930 Rosetta Predictions human pricing
NM_001108492 Rosetta Predictions rat pricing
NM_001040085 Rosetta Predictions mouse pricing
NM_001040086 Rosetta Predictions mouse pricing
NM_001040087 Rosetta Predictions mouse pricing
NM_001040088 Rosetta Predictions mouse pricing
NM_031394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066577 predicted 1500
2 SASI_Hs01_00066578 predicted 752
3 SASI_Hs01_00066580 predicted 1418
4 SASI_Hs01_00066581 predicted 1512
5 SASI_Hs01_00066582 predicted 771
6 SASI_Hs01_00066583 predicted 842
7 SASI_Hs01_00066584 predicted 789
8 SASI_Hs01_00066585 predicted 842
9 SASI_Hs01_00066586 predicted 771
10 SASI_Hs02_00359773 predicted 1521
11 SASI_Hs01_00066579 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105007 predicted 3085
2 SASI_Hs01_00105008 predicted 2333
3 SASI_Hs01_00105010 predicted 2998
4 SASI_Hs01_00105011 predicted 3093
5 SASI_Hs01_00105012 predicted 2348
6 SASI_Hs01_00105013 predicted 2428
7 SASI_Hs01_00105014 predicted 2361
8 SASI_Hs01_00105015 predicted 2428
9 SASI_Hs01_00105016 predicted 2347
10 SASI_Hs02_00360565 predicted 3105
11 SASI_Hs01_00105009 predicted 2839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226293 predicted 3907
2 SASI_Hs01_00226294 predicted 3155
3 SASI_Hs01_00226296 predicted 3818
4 SASI_Hs01_00226297 predicted 3913
5 SASI_Hs01_00226298 predicted 3175
6 SASI_Hs01_00226299 predicted 3244
7 SASI_Hs01_00226300 predicted 3188
8 SASI_Hs01_00226301 predicted 3251
9 SASI_Hs01_00226302 predicted 3172
10 SASI_Hs02_00373630 predicted 3927
11 SASI_Hs01_00226295 predicted 3663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154011 predicted 3856
2 SASI_Hs01_00154012 predicted 3105
3 SASI_Hs01_00154014 predicted 3772
4 SASI_Hs01_00154015 predicted 3866
5 SASI_Hs01_00154016 predicted 3127
6 SASI_Hs01_00154017 predicted 3196
7 SASI_Hs01_00154018 predicted 3135
8 SASI_Hs01_00154019 predicted 3196
9 SASI_Hs01_00154020 predicted 3123
10 SASI_Hs02_00373631 predicted 3871
11 SASI_Hs01_00154013 predicted 3614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203331 predicted 1546
2 SASI_Hs01_00203332 predicted 797
3 SASI_Hs01_00203334 predicted 1464
4 SASI_Hs01_00203335 predicted 1554
5 SASI_Hs01_00203336 predicted 809
6 SASI_Hs01_00203337 predicted 882
7 SASI_Hs01_00203338 predicted 825
8 SASI_Hs01_00203339 predicted 886
9 SASI_Hs01_00203340 predicted 804
10 SASI_Hs02_00373632 predicted 1565
11 SASI_Hs01_00203333 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092107 predicted 1549
2 SASI_Hs01_00092108 predicted 803
3 SASI_Hs01_00092110 predicted 1466
4 SASI_Hs01_00092111 predicted 1553
5 SASI_Hs01_00092112 predicted 818
6 SASI_Hs01_00092113 predicted 886
7 SASI_Hs01_00092114 predicted 827
8 SASI_Hs01_00092115 predicted 888
9 SASI_Hs01_00092116 predicted 814
10 SASI_Hs02_00373633 predicted 1564
11 SASI_Hs01_00092109 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239179 predicted 2805
2 SASI_Rn02_00239180 predicted 2885
3 SASI_Rn02_00239181 predicted 3058
4 SASI_Rn02_00239182 predicted 3670
5 SASI_Rn02_00239183 predicted 3483
6 SASI_Rn02_00239184 predicted 3753
7 SASI_Rn02_00239185 predicted 3840
8 SASI_Rn02_00239186 predicted 2828
9 SASI_Rn02_00239187 predicted 3309
10 SASI_Rn02_00239188 predicted 3226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144394 predicted 2998
2 SASI_Mm01_00144395 predicted 3012
3 SASI_Mm01_00144396 predicted 2540
4 SASI_Mm01_00144397 predicted 2406
5 SASI_Mm01_00144398 predicted 3055
6 SASI_Mm01_00144399 predicted 3117
7 SASI_Mm01_00144400 predicted 3102
8 SASI_Mm01_00144401 predicted 2884
9 SASI_Mm01_00144402 predicted 2202
10 SASI_Mm01_00144403 predicted 3178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164975 predicted 4033
2 SASI_Mm01_00164976 predicted 4046
3 SASI_Mm01_00164977 predicted 3576
4 SASI_Mm01_00164978 predicted 3435
5 SASI_Mm01_00164979 predicted 4087
6 SASI_Mm01_00164980 predicted 4149
7 SASI_Mm01_00164981 predicted 4143
8 SASI_Mm01_00164982 predicted 3919
9 SASI_Mm01_00164983 predicted 3236
10 SASI_Mm01_00164984 predicted 4202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290265 predicted 1449
2 SASI_Mm02_00290266 predicted 1649
3 SASI_Mm02_00290267 predicted 1027
4 SASI_Mm01_00027546 predicted 1270
5 SASI_Mm01_00027551 predicted 1069
6 SASI_Mm02_00290268 predicted 890
7 SASI_Mm02_00290269 predicted 1051
8 SASI_Mm02_00290270 predicted 822
9 SASI_Mm02_00290271 predicted 1634
10 SASI_Mm02_00290272 predicted 1088
11 SASI_Mm01_00027543 predicted 1875
12 SASI_Mm01_00027544 predicted 1886
13 SASI_Mm01_00027545 predicted 1421
14 SASI_Mm01_00027547 predicted 1922
15 SASI_Mm01_00027548 predicted 1990
16 SASI_Mm01_00027549 predicted 1977
17 SASI_Mm01_00027550 predicted 1750
18 SASI_Mm01_00027552 predicted 2052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040088 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083925 predicted 1797
2 SASI_Mm01_00083926 predicted 1808
3 SASI_Mm01_00083927 predicted 1336
4 SASI_Mm01_00083928 predicted 1199
5 SASI_Mm01_00083929 predicted 1848
6 SASI_Mm01_00083930 predicted 1912
7 SASI_Mm01_00083931 predicted 1904
8 SASI_Mm01_00083932 predicted 1679
9 SASI_Mm01_00083933 predicted 997
10 SASI_Mm01_00083934 predicted 1973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115695 predicted 2924
2 SASI_Mm01_00115696 predicted 2936
3 SASI_Mm01_00115697 predicted 2472
4 SASI_Mm01_00115698 predicted 2333
5 SASI_Mm01_00115699 predicted 2976
6 SASI_Mm01_00115700 predicted 3046
7 SASI_Mm01_00115701 predicted 3034
8 SASI_Mm01_00115702 predicted 2808
9 SASI_Mm01_00115703 predicted 2137
10 SASI_Mm01_00115704 predicted 3098
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031394
VALIDATED
SYTL2 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin-like 2
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031394.1-3155s1c1
Sequence:CCGGCCGACATTCAAGGAGAGAGTTCTCGAGAACTCTCTCCTTGAATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031394.1-1603s1c1
Sequence:CCGGGCTAGGAAATTGCCTTCCAAACTCGAGTTTGGAAGGCAATTTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031394.1-1918s1c1
Sequence:CCGGCCCAGCTCATTAACCAATCTTCTCGAGAAGATTGGTTAATGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031394.1-2259s1c1
Sequence:CCGGGCAATTCTTAAAGACGCAGAACTCGAGTTCTGCGTCTTTAAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031394.1-1718s1c1
Sequence:CCGGCCGACCAAGAACCAGATACAACTCGAGTTGTATCTGGTTCTTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-2109s21c1
Sequence:GTACCGGCAACGAGATATTGCGGTATAACTCGAGTTATACCGCAATATCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-498s21c1
Sequence:GTACCGGAGCTTCCAGTGTGATTGATATCTCGAGATATCAATCACACTGGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-897s21c1
Sequence:GTACCGGGGCTCCAAGAGGGATCCTAAACTCGAGTTTAGGATCCCTCTTGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-123s21c1
Sequence:GTACCGGGGAGCAAGACGCCATCTTAAACTCGAGTTTAAGATGGCGTCTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031394.2-2973s21c1
Sequence:GTACCGGGCACGACTCAAGGGAGTTAAACTCGAGTTTAACTCCCTTGAGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-600s21c1
Sequence:GTACCGGAGATCACTCCTTGCAACAAACCTCGAGGTTTGTTGCAAGGAGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-2010s21c1
Sequence:GTACCGGGCGCTCAGATCCGTATGTAAACTCGAGTTTACATACGGATCTGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-2613s21c1
Sequence:GTACCGGCACAGTCTGGGACCATTATAACTCGAGTTATAATGGTCCCAGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-1066s21c1
Sequence:GTACCGGAGCTCACTAGAGCCGTTAAAGCTCGAGCTTTAACGGCTCTAGTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031394.2-2883s21c1
Sequence:GTACCGGGAGTTGGCCTCATGGACAAATCTCGAGATTTGTCCATGAGGCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-945s21c1
Sequence:GTACCGGCTCAGAGACCCTCCGTTTAAACTCGAGTTTAAACGGAGGGTCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031394
VALIDATED
SYTL2 MISSION shRNA shRNA Plasmid DNA
synaptotagmin-like 2
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031394.1-3155s1c1
Sequence:CCGGCCGACATTCAAGGAGAGAGTTCTCGAGAACTCTCTCCTTGAATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031394.1-1603s1c1
Sequence:CCGGGCTAGGAAATTGCCTTCCAAACTCGAGTTTGGAAGGCAATTTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031394.1-1918s1c1
Sequence:CCGGCCCAGCTCATTAACCAATCTTCTCGAGAAGATTGGTTAATGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031394.1-2259s1c1
Sequence:CCGGGCAATTCTTAAAGACGCAGAACTCGAGTTCTGCGTCTTTAAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031394.1-1718s1c1
Sequence:CCGGCCGACCAAGAACCAGATACAACTCGAGTTGTATCTGGTTCTTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-2109s21c1
Sequence:GTACCGGCAACGAGATATTGCGGTATAACTCGAGTTATACCGCAATATCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-498s21c1
Sequence:GTACCGGAGCTTCCAGTGTGATTGATATCTCGAGATATCAATCACACTGGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-897s21c1
Sequence:GTACCGGGGCTCCAAGAGGGATCCTAAACTCGAGTTTAGGATCCCTCTTGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-123s21c1
Sequence:GTACCGGGGAGCAAGACGCCATCTTAAACTCGAGTTTAAGATGGCGTCTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031394.2-2973s21c1
Sequence:GTACCGGGCACGACTCAAGGGAGTTAAACTCGAGTTTAACTCCCTTGAGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-600s21c1
Sequence:GTACCGGAGATCACTCCTTGCAACAAACCTCGAGGTTTGTTGCAAGGAGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-2010s21c1
Sequence:GTACCGGGCGCTCAGATCCGTATGTAAACTCGAGTTTACATACGGATCTGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-2613s21c1
Sequence:GTACCGGCACAGTCTGGGACCATTATAACTCGAGTTATAATGGTCCCAGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-1066s21c1
Sequence:GTACCGGAGCTCACTAGAGCCGTTAAAGCTCGAGCTTTAACGGCTCTAGTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031394.2-2883s21c1
Sequence:GTACCGGGAGTTGGCCTCATGGACAAATCTCGAGATTTGTCCATGAGGCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-945s21c1
Sequence:GTACCGGCTCAGAGACCCTCCGTTTAAACTCGAGTTTAAACGGAGGGTCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031394
VALIDATED
SYTL2 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin-like 2
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031394.1-3155s1c1
Sequence:CCGGCCGACATTCAAGGAGAGAGTTCTCGAGAACTCTCTCCTTGAATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031394.1-1603s1c1
Sequence:CCGGGCTAGGAAATTGCCTTCCAAACTCGAGTTTGGAAGGCAATTTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031394.1-1918s1c1
Sequence:CCGGCCCAGCTCATTAACCAATCTTCTCGAGAAGATTGGTTAATGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031394.1-2259s1c1
Sequence:CCGGGCAATTCTTAAAGACGCAGAACTCGAGTTCTGCGTCTTTAAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031394.1-1718s1c1
Sequence:CCGGCCGACCAAGAACCAGATACAACTCGAGTTGTATCTGGTTCTTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-2109s21c1
Sequence:GTACCGGCAACGAGATATTGCGGTATAACTCGAGTTATACCGCAATATCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-498s21c1
Sequence:GTACCGGAGCTTCCAGTGTGATTGATATCTCGAGATATCAATCACACTGGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-897s21c1
Sequence:GTACCGGGGCTCCAAGAGGGATCCTAAACTCGAGTTTAGGATCCCTCTTGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-123s21c1
Sequence:GTACCGGGGAGCAAGACGCCATCTTAAACTCGAGTTTAAGATGGCGTCTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031394.2-2973s21c1
Sequence:GTACCGGGCACGACTCAAGGGAGTTAAACTCGAGTTTAACTCCCTTGAGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-600s21c1
Sequence:GTACCGGAGATCACTCCTTGCAACAAACCTCGAGGTTTGTTGCAAGGAGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-2010s21c1
Sequence:GTACCGGGCGCTCAGATCCGTATGTAAACTCGAGTTTACATACGGATCTGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-2613s21c1
Sequence:GTACCGGCACAGTCTGGGACCATTATAACTCGAGTTATAATGGTCCCAGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-1066s21c1
Sequence:GTACCGGAGCTCACTAGAGCCGTTAAAGCTCGAGCTTTAACGGCTCTAGTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031394.2-2883s21c1
Sequence:GTACCGGGAGTTGGCCTCATGGACAAATCTCGAGATTTGTCCATGAGGCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031394.2-945s21c1
Sequence:GTACCGGCTCAGAGACCCTCCGTTTAAACTCGAGTTTAAACGGAGGGTCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032379
VALIDATED
SYTL2 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin-like 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032379.3-1472s1c1
Sequence:CCGGCGGTGGAATCTGATCTTGAAACTCGAGTTTCAAGATCAGATTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032379.3-637s1c1
Sequence:CCGGGCCTATTTGCTACCAGACAAACTCGAGTTTGTCTGGTAGCAAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032379.3-1146s1c1
Sequence:CCGGCCCTATCTTCAACCACACTATCTCGAGATAGTGTGGTTGAAGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032379.3-1028s1c1
Sequence:CCGGGCCTTGATCTACCACTGCTAACTCGAGTTAGCAGTGGTAGATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032379.3-787s1c1
Sequence:CCGGCGGGATACATTTAAGCGCAATCTCGAGATTGCGCTTAAATGTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-638s21c1
Sequence:GTACCGGCCTATTTGCTACCAGACAAAGCTCGAGCTTTGTCTGGTAGCAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-588s21c1
Sequence:CCGGCTTAGCAGCAGCGGATGTAAACTCGAGTTTACATCCGCTGCTGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-405s21c1
Sequence:GTACCGGGAGCTCTTTAACCAATCTTAGCTCGAGCTAAGATTGGTTAAAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-503s21c1
Sequence:GTACCGGTGGAAGTTAAAGGAAATATTCCTCGAGGAATATTTCCTTTAACTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032379.3-1912s21c1
Sequence:GTACCGGTGGACCTTAAGAAACTATTTACTCGAGTAAATAGTTTCTTAAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032379.3-1845s21c1
Sequence:CCGGGTCGCAGAAAGATACTCAAAGCTCGAGCTTTGAGTATCTTTCTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-778s21c1
Sequence:CCGGATTTGGCATCGGGATACATTTCTCGAGAAATGTATCCCGATGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-714s21c1
Sequence:CCGGTAACGAAATACTGCGGTATAACTCGAGTTATACCGCAGTATTTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-462s21c1
Sequence:GTACCGGTGGCAGTGTGATGAGTGTTTACTCGAGTAAACACTCATCACACTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032379
VALIDATED
SYTL2 MISSION shRNA shRNA Plasmid DNA
synaptotagmin-like 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032379.3-1472s1c1
Sequence:CCGGCGGTGGAATCTGATCTTGAAACTCGAGTTTCAAGATCAGATTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032379.3-637s1c1
Sequence:CCGGGCCTATTTGCTACCAGACAAACTCGAGTTTGTCTGGTAGCAAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032379.3-1146s1c1
Sequence:CCGGCCCTATCTTCAACCACACTATCTCGAGATAGTGTGGTTGAAGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032379.3-1028s1c1
Sequence:CCGGGCCTTGATCTACCACTGCTAACTCGAGTTAGCAGTGGTAGATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032379.3-787s1c1
Sequence:CCGGCGGGATACATTTAAGCGCAATCTCGAGATTGCGCTTAAATGTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-638s21c1
Sequence:GTACCGGCCTATTTGCTACCAGACAAAGCTCGAGCTTTGTCTGGTAGCAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-588s21c1
Sequence:CCGGCTTAGCAGCAGCGGATGTAAACTCGAGTTTACATCCGCTGCTGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-405s21c1
Sequence:GTACCGGGAGCTCTTTAACCAATCTTAGCTCGAGCTAAGATTGGTTAAAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-503s21c1
Sequence:GTACCGGTGGAAGTTAAAGGAAATATTCCTCGAGGAATATTTCCTTTAACTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032379.3-1912s21c1
Sequence:GTACCGGTGGACCTTAAGAAACTATTTACTCGAGTAAATAGTTTCTTAAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032379.3-1845s21c1
Sequence:CCGGGTCGCAGAAAGATACTCAAAGCTCGAGCTTTGAGTATCTTTCTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-778s21c1
Sequence:CCGGATTTGGCATCGGGATACATTTCTCGAGAAATGTATCCCGATGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-714s21c1
Sequence:CCGGTAACGAAATACTGCGGTATAACTCGAGTTATACCGCAGTATTTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-462s21c1
Sequence:GTACCGGTGGCAGTGTGATGAGTGTTTACTCGAGTAAACACTCATCACACTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032379
VALIDATED
SYTL2 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin-like 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032379.3-1472s1c1
Sequence:CCGGCGGTGGAATCTGATCTTGAAACTCGAGTTTCAAGATCAGATTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032379.3-637s1c1
Sequence:CCGGGCCTATTTGCTACCAGACAAACTCGAGTTTGTCTGGTAGCAAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032379.3-1146s1c1
Sequence:CCGGCCCTATCTTCAACCACACTATCTCGAGATAGTGTGGTTGAAGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032379.3-1028s1c1
Sequence:CCGGGCCTTGATCTACCACTGCTAACTCGAGTTAGCAGTGGTAGATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032379.3-787s1c1
Sequence:CCGGCGGGATACATTTAAGCGCAATCTCGAGATTGCGCTTAAATGTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-638s21c1
Sequence:GTACCGGCCTATTTGCTACCAGACAAAGCTCGAGCTTTGTCTGGTAGCAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-588s21c1
Sequence:CCGGCTTAGCAGCAGCGGATGTAAACTCGAGTTTACATCCGCTGCTGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-405s21c1
Sequence:GTACCGGGAGCTCTTTAACCAATCTTAGCTCGAGCTAAGATTGGTTAAAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-503s21c1
Sequence:GTACCGGTGGAAGTTAAAGGAAATATTCCTCGAGGAATATTTCCTTTAACTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032379.3-1912s21c1
Sequence:GTACCGGTGGACCTTAAGAAACTATTTACTCGAGTAAATAGTTTCTTAAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032379.3-1845s21c1
Sequence:CCGGGTCGCAGAAAGATACTCAAAGCTCGAGCTTTGAGTATCTTTCTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-778s21c1
Sequence:CCGGATTTGGCATCGGGATACATTTCTCGAGAAATGTATCCCGATGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-714s21c1
Sequence:CCGGTAACGAAATACTGCGGTATAACTCGAGTTATACCGCAGTATTTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032379.3-462s21c1
Sequence:GTACCGGTGGCAGTGTGATGAGTGTTTACTCGAGTAAACACTCATCACACTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks