EMAIL THIS PAGE TO A FRIEND

SYTL3

synaptotagmin-like 3

Synonyms: SLP3
UniProtKB ID: Q4VX76, Q496J4, Q496J6, Q5U3B9
Gene ID:
Human(94120) Summary: The protein encoded by this gene belongs to the family of synaptotagmin-like proteins (SLPs). SLPs are peripheral membrane proteins that interact with RAB27A protein, and play a role in vesicular trafficking. Unlike, SLPs 1 and 2, this protein binds phospholipids in the presence of calcium ions. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Mouse(83672) synaptotagmin-like 3
Rat(499017) synaptotagmin-like 3
Zebrafish(562333) synaptotagmin-like 3
chicken(100858462) synaptotagmin-like 3
Horse(100050996) synaptotagmin-like 3
domestic cat(101096235) synaptotagmin-like 3
dog(484055) synaptotagmin-like 3
domestic guinea pig(100718303) synaptotagmin-like 3
naked mole-rat(101720818) synaptotagmin-like 3
cow(506884) synaptotagmin-like 3
sheep(101109544) synaptotagmin-like 3
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009991 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009991 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009991 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009991 Rosetta Predictions human pricing
NM_001127560 Rosetta Predictions rat pricing
NM_031395 Rosetta Predictions mouse pricing
NM_183367 Rosetta Predictions mouse pricing
NM_183368 Rosetta Predictions mouse pricing
NM_183369 Rosetta Predictions mouse pricing
NM_183370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305763 predicted 1672
2 SASI_Hs01_00139882 predicted 1885
3 SASI_Hs02_00305764 predicted 1995
4 SASI_Hs01_00139884 predicted 923
5 SASI_Hs01_00139885 predicted 1590
6 SASI_Hs01_00139886 predicted 810
7 SASI_Hs01_00139887 predicted 1083
8 SASI_Hs01_00139888 predicted 1507
9 SASI_Hs01_00139889 predicted 1034
10 SASI_Hs02_00305765 predicted 416
11 SASI_Hs01_00139883 predicted 331
12 SASI_Hs01_00139890 predicted 1378
13 SASI_Hs01_00139891 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254353 predicted 1202
2 SASI_Rn02_00254354 predicted 1138
3 SASI_Rn02_00254355 predicted 619
4 SASI_Rn02_00254356 predicted 1608
5 SASI_Rn02_00254357 predicted 1198
6 SASI_Rn02_00254358 predicted 1976
7 SASI_Rn02_00254359 predicted 1309
8 SASI_Rn02_00254360 predicted 1029
9 SASI_Rn02_00254361 predicted 253
10 SASI_Rn02_00254362 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055055 predicted 1742
2 SASI_Mm01_00055056 predicted 1694
3 SASI_Mm01_00055057 predicted 1868
4 SASI_Mm01_00055058 predicted 1228
5 SASI_Mm02_00337144 predicted 1381
6 SASI_Mm01_00055059 predicted 1616
7 SASI_Mm01_00055060 predicted 1326
8 SASI_Mm01_00055061 predicted 1851
9 SASI_Mm01_00055062 predicted 1753
10 SASI_Mm01_00055063 predicted 1542
11 SASI_Mm01_00055064 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186525 predicted 1885
2 SASI_Mm01_00186526 predicted 1839
3 SASI_Mm01_00186527 predicted 2015
4 SASI_Mm01_00186528 predicted 1374
5 SASI_Mm02_00350485 predicted 1531
6 SASI_Mm01_00186529 predicted 1761
7 SASI_Mm01_00186530 predicted 1467
8 SASI_Mm01_00186531 predicted 2003
9 SASI_Mm01_00186532 predicted 1901
10 SASI_Mm01_00186533 predicted 1683
11 SASI_Mm01_00186534 predicted 1359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161690 predicted 978
2 SASI_Mm01_00161691 predicted 920
3 SASI_Mm02_00350486 predicted 613
4 SASI_Mm01_00161694 predicted 846
5 SASI_Mm01_00161695 predicted 562
6 SASI_Mm01_00161697 predicted 991
7 SASI_Mm01_00161698 predicted 772
8 SASI_Mm02_00350487 predicted 922
9 SASI_Mm02_00350488 predicted 1092
10 SASI_Mm02_00350489 predicted 989
11 SASI_Mm01_00161692 predicted 1109
12 SASI_Mm01_00161693 predicted 468
13 SASI_Mm01_00161696 predicted 1095
14 SASI_Mm01_00161699 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109730 predicted 1665
2 SASI_Mm01_00109731 predicted 1615
3 SASI_Mm01_00109732 predicted 1785
4 SASI_Mm01_00109733 predicted 1147
5 SASI_Mm02_00350490 predicted 1301
6 SASI_Mm01_00109734 predicted 1534
7 SASI_Mm01_00109735 predicted 1244
8 SASI_Mm01_00109736 predicted 1772
9 SASI_Mm01_00109737 predicted 1675
10 SASI_Mm01_00109738 predicted 1463
11 SASI_Mm01_00109739 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193570 predicted 1085
2 SASI_Mm01_00193571 predicted 1034
3 SASI_Mm02_00350491 predicted 729
4 SASI_Mm01_00193574 predicted 962
5 SASI_Mm01_00193575 predicted 670
6 SASI_Mm01_00193577 predicted 1102
7 SASI_Mm01_00193578 predicted 887
8 SASI_Mm02_00350492 predicted 1033
9 SASI_Mm02_00350493 predicted 1204
10 SASI_Mm02_00350494 predicted 1095
11 SASI_Mm01_00193572 predicted 1216
12 SASI_Mm01_00193573 predicted 572
13 SASI_Mm01_00193576 predicted 1204
14 SASI_Mm01_00193579 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009991
SYTL3 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin-like 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009991.2-901s21c1
Sequence:CCGGAGGTCAGTGCACCAGATATTCCTCGAGGAATATCTGGTGCACTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009991.2-1607s21c1
Sequence:CCGGATCACTTCATGGTCAACTTTGCTCGAGCAAAGTTGACCATGAAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009991.2-1635s21c1
Sequence:CCGGGTGCTAGGAGCCAAGAATTTACTCGAGTAAATTCTTGGCTCCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009991.1-893s1c1
Sequence:CCGGCAAATGCTCTACTAACCCTATCTCGAGATAGGGTTAGTAGAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009991.1-1618s1c1
Sequence:CCGGGCACCTTGAACTCATTTGTTACTCGAGTAACAAATGAGTTCAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009991.1-1335s1c1
Sequence:CCGGCGGAGAGTGTTTCTTGGAGAACTCGAGTTCTCCAAGAAACACTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009991.1-1437s1c1
Sequence:CCGGGAGAAATACGAAGACAGCGTTCTCGAGAACGCTGTCTTCGTATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009991
SYTL3 MISSION shRNA shRNA Plasmid DNA
synaptotagmin-like 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009991.2-901s21c1
Sequence:CCGGAGGTCAGTGCACCAGATATTCCTCGAGGAATATCTGGTGCACTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009991.2-1607s21c1
Sequence:CCGGATCACTTCATGGTCAACTTTGCTCGAGCAAAGTTGACCATGAAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009991.2-1635s21c1
Sequence:CCGGGTGCTAGGAGCCAAGAATTTACTCGAGTAAATTCTTGGCTCCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009991.1-893s1c1
Sequence:CCGGCAAATGCTCTACTAACCCTATCTCGAGATAGGGTTAGTAGAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009991.1-1618s1c1
Sequence:CCGGGCACCTTGAACTCATTTGTTACTCGAGTAACAAATGAGTTCAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009991.1-1335s1c1
Sequence:CCGGCGGAGAGTGTTTCTTGGAGAACTCGAGTTCTCCAAGAAACACTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009991.1-1437s1c1
Sequence:CCGGGAGAAATACGAAGACAGCGTTCTCGAGAACGCTGTCTTCGTATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009991
SYTL3 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin-like 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009991.2-901s21c1
Sequence:CCGGAGGTCAGTGCACCAGATATTCCTCGAGGAATATCTGGTGCACTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009991.2-1607s21c1
Sequence:CCGGATCACTTCATGGTCAACTTTGCTCGAGCAAAGTTGACCATGAAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009991.2-1635s21c1
Sequence:CCGGGTGCTAGGAGCCAAGAATTTACTCGAGTAAATTCTTGGCTCCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009991.1-893s1c1
Sequence:CCGGCAAATGCTCTACTAACCCTATCTCGAGATAGGGTTAGTAGAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009991.1-1618s1c1
Sequence:CCGGGCACCTTGAACTCATTTGTTACTCGAGTAACAAATGAGTTCAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009991.1-1335s1c1
Sequence:CCGGCGGAGAGTGTTTCTTGGAGAACTCGAGTTCTCCAAGAAACACTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009991.1-1437s1c1
Sequence:CCGGGAGAAATACGAAGACAGCGTTCTCGAGAACGCTGTCTTCGTATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031395
SYTL3 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin-like 3
Mouse
21 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1120s21c1
Sequence:GTACCGGTTGAGACACGGAAGCTTAATTCTCGAGAATTAAGCTTCCGTGTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1394s21c1
Sequence:CCGGTCGAGGAAACCTTGAAGTATCCTCGAGGATACTTCAAGGTTTCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1382s21c1
Sequence:CCGGTGGACCCGACTTTCGAGGAAACTCGAGTTTCCTCGAAAGTCGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1294s21c1
Sequence:CCGGAGAAAGTGCAATCCGTATGTCCTCGAGGACATACGGATTGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1128s21c1
Sequence:CCGGCGGAAGCTTAATTAGCATCAACTCGAGTTGATGCTAATTAAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1533s21c1
Sequence:CCGGTAAGGACAGTACGGCACAGAACTCGAGTTCTGTGCCGTACTGTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-2019s21c1
Sequence:CCGGAGGTTCACAGTCCAAGCTTCACTCGAGTGAAGCTTGGACTGTGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1586s21c1
Sequence:CCGGAGAAATACGAAGAGAATATTCCTCGAGGAATATTCTCTTCGTATTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031395.2-2120s21c1
Sequence:CCGGGCGAACCCACAAAGGTCAACACTCGAGTGTTGACCTTTGTGGGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-2061s21c1
Sequence:CCGGCCCAAACCTGTGGACAGACATCTCGAGATGTCTGTCCACAGGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1623s21c1
Sequence:CCGGACTTGCTGTTCGAGCCAAATTCTCGAGAATTTGGCTCGAACAGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1489s21c1
Sequence:CCGGGTGTTCCTCGGAGAAGTGATCCTCGAGGATCACTTCTCCGAGGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1695s21c1
Sequence:CCGGAGCGCTTAATGGTCAACTGTGCTCGAGCACAGTTGACCATTAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1723s21c1
Sequence:CCGGGTGTTGGGAGCCAAGAATTTACTCGAGTAAATTCTTGGCTCCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031395.2-2136s21c1
Sequence:CCGGCAACAGGAAGTGGGATCATGGCTCGAGCCATGATCCCACTTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1548s21c1
Sequence:CCGGACAGAATGCCAGATGGTATCCCTCGAGGGATACCATCTGGCATTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-1210s1c1
Sequence:CCGGGCCATTCATTACTGCGTTAAACTCGAGTTTAACGCAGTAATGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-1935s1c1
Sequence:CCGGCCAGGCCATCTTTGGTATGAACTCGAGTTCATACCAAAGATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-1209s1c1
Sequence:CCGGTGCCATTCATTACTGCGTTAACTCGAGTTAACGCAGTAATGAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-587s1c1
Sequence:CCGGCGGTTTGCTTTGAGGACAGAACTCGAGTTCTGTCCTCAAAGCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-1760s1c1
Sequence:CCGGGCACCTTAAACTCATTTGTTACTCGAGTAACAAATGAGTTTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031395
SYTL3 MISSION shRNA shRNA Plasmid DNA
synaptotagmin-like 3
Mouse
21 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1120s21c1
Sequence:GTACCGGTTGAGACACGGAAGCTTAATTCTCGAGAATTAAGCTTCCGTGTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1394s21c1
Sequence:CCGGTCGAGGAAACCTTGAAGTATCCTCGAGGATACTTCAAGGTTTCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1382s21c1
Sequence:CCGGTGGACCCGACTTTCGAGGAAACTCGAGTTTCCTCGAAAGTCGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1294s21c1
Sequence:CCGGAGAAAGTGCAATCCGTATGTCCTCGAGGACATACGGATTGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1128s21c1
Sequence:CCGGCGGAAGCTTAATTAGCATCAACTCGAGTTGATGCTAATTAAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1533s21c1
Sequence:CCGGTAAGGACAGTACGGCACAGAACTCGAGTTCTGTGCCGTACTGTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-2019s21c1
Sequence:CCGGAGGTTCACAGTCCAAGCTTCACTCGAGTGAAGCTTGGACTGTGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1586s21c1
Sequence:CCGGAGAAATACGAAGAGAATATTCCTCGAGGAATATTCTCTTCGTATTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031395.2-2120s21c1
Sequence:CCGGGCGAACCCACAAAGGTCAACACTCGAGTGTTGACCTTTGTGGGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-2061s21c1
Sequence:CCGGCCCAAACCTGTGGACAGACATCTCGAGATGTCTGTCCACAGGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1623s21c1
Sequence:CCGGACTTGCTGTTCGAGCCAAATTCTCGAGAATTTGGCTCGAACAGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1489s21c1
Sequence:CCGGGTGTTCCTCGGAGAAGTGATCCTCGAGGATCACTTCTCCGAGGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1695s21c1
Sequence:CCGGAGCGCTTAATGGTCAACTGTGCTCGAGCACAGTTGACCATTAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1723s21c1
Sequence:CCGGGTGTTGGGAGCCAAGAATTTACTCGAGTAAATTCTTGGCTCCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031395.2-2136s21c1
Sequence:CCGGCAACAGGAAGTGGGATCATGGCTCGAGCCATGATCCCACTTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1548s21c1
Sequence:CCGGACAGAATGCCAGATGGTATCCCTCGAGGGATACCATCTGGCATTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-1210s1c1
Sequence:CCGGGCCATTCATTACTGCGTTAAACTCGAGTTTAACGCAGTAATGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-1935s1c1
Sequence:CCGGCCAGGCCATCTTTGGTATGAACTCGAGTTCATACCAAAGATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-1209s1c1
Sequence:CCGGTGCCATTCATTACTGCGTTAACTCGAGTTAACGCAGTAATGAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-587s1c1
Sequence:CCGGCGGTTTGCTTTGAGGACAGAACTCGAGTTCTGTCCTCAAAGCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-1760s1c1
Sequence:CCGGGCACCTTAAACTCATTTGTTACTCGAGTAACAAATGAGTTTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031395
SYTL3 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin-like 3
Mouse
21 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1120s21c1
Sequence:GTACCGGTTGAGACACGGAAGCTTAATTCTCGAGAATTAAGCTTCCGTGTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1394s21c1
Sequence:CCGGTCGAGGAAACCTTGAAGTATCCTCGAGGATACTTCAAGGTTTCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1382s21c1
Sequence:CCGGTGGACCCGACTTTCGAGGAAACTCGAGTTTCCTCGAAAGTCGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1294s21c1
Sequence:CCGGAGAAAGTGCAATCCGTATGTCCTCGAGGACATACGGATTGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.1-1128s21c1
Sequence:CCGGCGGAAGCTTAATTAGCATCAACTCGAGTTGATGCTAATTAAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1533s21c1
Sequence:CCGGTAAGGACAGTACGGCACAGAACTCGAGTTCTGTGCCGTACTGTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-2019s21c1
Sequence:CCGGAGGTTCACAGTCCAAGCTTCACTCGAGTGAAGCTTGGACTGTGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1586s21c1
Sequence:CCGGAGAAATACGAAGAGAATATTCCTCGAGGAATATTCTCTTCGTATTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031395.2-2120s21c1
Sequence:CCGGGCGAACCCACAAAGGTCAACACTCGAGTGTTGACCTTTGTGGGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-2061s21c1
Sequence:CCGGCCCAAACCTGTGGACAGACATCTCGAGATGTCTGTCCACAGGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1623s21c1
Sequence:CCGGACTTGCTGTTCGAGCCAAATTCTCGAGAATTTGGCTCGAACAGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1489s21c1
Sequence:CCGGGTGTTCCTCGGAGAAGTGATCCTCGAGGATCACTTCTCCGAGGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1695s21c1
Sequence:CCGGAGCGCTTAATGGTCAACTGTGCTCGAGCACAGTTGACCATTAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1723s21c1
Sequence:CCGGGTGTTGGGAGCCAAGAATTTACTCGAGTAAATTCTTGGCTCCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031395.2-2136s21c1
Sequence:CCGGCAACAGGAAGTGGGATCATGGCTCGAGCCATGATCCCACTTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031395.2-1548s21c1
Sequence:CCGGACAGAATGCCAGATGGTATCCCTCGAGGGATACCATCTGGCATTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-1210s1c1
Sequence:CCGGGCCATTCATTACTGCGTTAAACTCGAGTTTAACGCAGTAATGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-1935s1c1
Sequence:CCGGCCAGGCCATCTTTGGTATGAACTCGAGTTCATACCAAAGATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-1209s1c1
Sequence:CCGGTGCCATTCATTACTGCGTTAACTCGAGTTAACGCAGTAATGAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-587s1c1
Sequence:CCGGCGGTTTGCTTTGAGGACAGAACTCGAGTTCTGTCCTCAAAGCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031395.1-1760s1c1
Sequence:CCGGGCACCTTAAACTCATTTGTTACTCGAGTAACAAATGAGTTTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks