EMAIL THIS PAGE TO A FRIEND

SYTL4

synaptotagmin-like 4

Synonyms: SLP4
UniProtKB ID: Q96C24, Q5H9J3, Q5JPG8, Q8N9P4, Q9H4R0, Q9H4R1
Gene ID:
Human(94121) Summary: This gene encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in intracellular membrane trafficking. This protein binds Rab27 and may be involved in inhibiting dense core vesicle exocytosis. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Mar 2010]
Mouse(27359) synaptotagmin-like 4
Rat(140594) synaptotagmin-like 4
cow(515978) synaptotagmin-like 4
sheep(101102960) synaptotagmin-like 4
naked mole-rat(101720565) synaptotagmin-like 4
domestic guinea pig(100720350) synaptotagmin-like 4
Zebrafish(553322) synaptotagmin-like 4
Horse(100057306) synaptotagmin-like 4
domestic cat(101085864) synaptotagmin-like 4
dog(100687098) synaptotagmin-like 4
chicken(422260) synaptotagmin-like 4
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0249 AQUA Peptide EPLASNDFLGGV[R] cow, human, mouse, rat pricing
AQ0248 AQUA Peptide DLILSVLQ[R] cow, human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080737 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080737 Rosetta Predictions human pricing
NM_080410 Rosetta Predictions rat pricing
NM_013757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215937 predicted 1583
2 SASI_Hs01_00215938 predicted 1573
3 SASI_Hs01_00215939 predicted 1690
4 SASI_Hs01_00215940 predicted 1497
5 SASI_Hs02_00362521 predicted 2061
6 SASI_Hs01_00215941 predicted 1008
7 SASI_Hs01_00215942 predicted 1618
8 SASI_Hs01_00215943 predicted 864
9 SASI_Hs01_00215944 predicted 2054
10 SASI_Hs01_00215945 predicted 815
11 SASI_Hs01_00215946 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067931 predicted 1234
2 SASI_Rn01_00067932 predicted 1148
3 SASI_Rn01_00067933 predicted 1341
4 SASI_Rn01_00067935 predicted 367
5 SASI_Rn01_00067937 predicted 679
6 SASI_Rn01_00067938 predicted 933
7 SASI_Rn01_00067939 predicted 246
8 SASI_Rn02_00267230 predicted 261
9 SASI_Rn02_00267231 predicted 234
10 SASI_Rn01_00067940 predicted 1160
11 SASI_Rn01_00067934 predicted 957
12 SASI_Rn01_00067936 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069084 predicted 1422
2 SASI_Mm01_00069085 predicted 1010
3 SASI_Mm01_00069086 predicted 1018
4 SASI_Mm01_00069087 predicted 441
5 SASI_Mm02_00322704 predicted 1305
6 SASI_Mm01_00069088 predicted 1121
7 SASI_Mm01_00069089 predicted 224
8 SASI_Mm01_00069090 predicted 1440
9 SASI_Mm01_00069091 predicted 1353
10 SASI_Mm01_00069092 predicted 684
11 SASI_Mm01_00069093 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013757
SYTL4 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin-like 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013757.1-3537s1c1
Sequence:CCGGGCAGCTAAAGTGATTAAGATTCTCGAGAATCTTAATCACTTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013757.1-218s1c1
Sequence:CCGGCGAGATGGAAAGGGATTTGATCTCGAGATCAAATCCCTTTCCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013757.1-2168s1c1
Sequence:CCGGGCTCCGTTCTTCAATGGTCAACTCGAGTTGACCATTGAAGAACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013757.1-826s1c1
Sequence:CCGGCCAGGAGAGATTCTCTGGATACTCGAGTATCCAGAGAATCTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013757.1-1207s1c1
Sequence:CCGGGCAGCATTATGAGTATCTATACTCGAGTATAGATACTCATAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013757.1-1468s21c1
Sequence:GTACCGGAGACCTTTCGGTACGAGATTTCTCGAGAAATCTCGTACCGAAAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013757.1-422s21c1
Sequence:GTACCGGTTGTGTGGGCTGCAATCATTTCTCGAGAAATGATTGCAGCCCACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013757
SYTL4 MISSION shRNA shRNA Plasmid DNA
synaptotagmin-like 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013757.1-3537s1c1
Sequence:CCGGGCAGCTAAAGTGATTAAGATTCTCGAGAATCTTAATCACTTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013757.1-218s1c1
Sequence:CCGGCGAGATGGAAAGGGATTTGATCTCGAGATCAAATCCCTTTCCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013757.1-2168s1c1
Sequence:CCGGGCTCCGTTCTTCAATGGTCAACTCGAGTTGACCATTGAAGAACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013757.1-826s1c1
Sequence:CCGGCCAGGAGAGATTCTCTGGATACTCGAGTATCCAGAGAATCTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013757.1-1207s1c1
Sequence:CCGGGCAGCATTATGAGTATCTATACTCGAGTATAGATACTCATAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013757.1-1468s21c1
Sequence:GTACCGGAGACCTTTCGGTACGAGATTTCTCGAGAAATCTCGTACCGAAAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013757.1-422s21c1
Sequence:GTACCGGTTGTGTGGGCTGCAATCATTTCTCGAGAAATGATTGCAGCCCACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013757
SYTL4 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin-like 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013757.1-3537s1c1
Sequence:CCGGGCAGCTAAAGTGATTAAGATTCTCGAGAATCTTAATCACTTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013757.1-218s1c1
Sequence:CCGGCGAGATGGAAAGGGATTTGATCTCGAGATCAAATCCCTTTCCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013757.1-2168s1c1
Sequence:CCGGGCTCCGTTCTTCAATGGTCAACTCGAGTTGACCATTGAAGAACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013757.1-826s1c1
Sequence:CCGGCCAGGAGAGATTCTCTGGATACTCGAGTATCCAGAGAATCTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013757.1-1207s1c1
Sequence:CCGGGCAGCATTATGAGTATCTATACTCGAGTATAGATACTCATAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013757.1-1468s21c1
Sequence:GTACCGGAGACCTTTCGGTACGAGATTTCTCGAGAAATCTCGTACCGAAAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013757.1-422s21c1
Sequence:GTACCGGTTGTGTGGGCTGCAATCATTTCTCGAGAAATGATTGCAGCCCACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080737
SYTL4 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin-like 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-1581s1c1
Sequence:CCGGCGGGACACTGTTAATCCACTACTCGAGTAGTGGATTAACAGTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-647s1c1
Sequence:CCGGCGCCAAGGAAATAGAGTTGAACTCGAGTTCAACTCTATTTCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-1140s1c1
Sequence:CCGGGAGTACACTAAATCTGTGATACTCGAGTATCACAGATTTAGTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-1763s1c1
Sequence:CCGGCCTCCCTTTACATGGAAAGATCTCGAGATCTTTCCATGTAAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-2058s1c1
Sequence:CCGGCCTCACTACAACCATACATTTCTCGAGAAATGTATGGTTGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-1751s21c1
Sequence:GTACCGGGGATTCCTGGAAGCTTGATAACTCGAGTTATCAAGCTTCCAGGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080737.2-2854s21c1
Sequence:GTACCGGTCTTTCTCCTCTCCAATTTATCTCGAGATAAATTGGAGAGGAGAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080737.2-2797s21c1
Sequence:GTACCGGGAAGCAGGGTTGGTTAGTAAACTCGAGTTTACTAACCAACCCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-1110s21c1
Sequence:GTACCGGGATGAGGGTGAGATGATATTTCTCGAGAAATATCATCTCACCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080737.2-2749s21c1
Sequence:GTACCGGCCCTGGCTACCTTTCGCATTACTCGAGTAATGCGAAAGGTAGCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-886s21c1
Sequence:GTACCGGAGGAGCCCAGTGTGCTATTTGCTCGAGCAAATAGCACACTGGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-466s21c1
Sequence:GTACCGGGGCGACTAAAGAATGAGTTACCTCGAGGTAACTCATTCTTTAGTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-742s21c1
Sequence:GTACCGGACCGCACAGGTAGTGAGATAACTCGAGTTATCTCACTACCTGTGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080737
SYTL4 MISSION shRNA shRNA Plasmid DNA
synaptotagmin-like 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-1581s1c1
Sequence:CCGGCGGGACACTGTTAATCCACTACTCGAGTAGTGGATTAACAGTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-647s1c1
Sequence:CCGGCGCCAAGGAAATAGAGTTGAACTCGAGTTCAACTCTATTTCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-1140s1c1
Sequence:CCGGGAGTACACTAAATCTGTGATACTCGAGTATCACAGATTTAGTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-1763s1c1
Sequence:CCGGCCTCCCTTTACATGGAAAGATCTCGAGATCTTTCCATGTAAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-2058s1c1
Sequence:CCGGCCTCACTACAACCATACATTTCTCGAGAAATGTATGGTTGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-1751s21c1
Sequence:GTACCGGGGATTCCTGGAAGCTTGATAACTCGAGTTATCAAGCTTCCAGGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080737.2-2854s21c1
Sequence:GTACCGGTCTTTCTCCTCTCCAATTTATCTCGAGATAAATTGGAGAGGAGAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080737.2-2797s21c1
Sequence:GTACCGGGAAGCAGGGTTGGTTAGTAAACTCGAGTTTACTAACCAACCCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-1110s21c1
Sequence:GTACCGGGATGAGGGTGAGATGATATTTCTCGAGAAATATCATCTCACCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080737.2-2749s21c1
Sequence:GTACCGGCCCTGGCTACCTTTCGCATTACTCGAGTAATGCGAAAGGTAGCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-886s21c1
Sequence:GTACCGGAGGAGCCCAGTGTGCTATTTGCTCGAGCAAATAGCACACTGGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-466s21c1
Sequence:GTACCGGGGCGACTAAAGAATGAGTTACCTCGAGGTAACTCATTCTTTAGTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-742s21c1
Sequence:GTACCGGACCGCACAGGTAGTGAGATAACTCGAGTTATCTCACTACCTGTGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080737
SYTL4 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin-like 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-1581s1c1
Sequence:CCGGCGGGACACTGTTAATCCACTACTCGAGTAGTGGATTAACAGTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-647s1c1
Sequence:CCGGCGCCAAGGAAATAGAGTTGAACTCGAGTTCAACTCTATTTCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-1140s1c1
Sequence:CCGGGAGTACACTAAATCTGTGATACTCGAGTATCACAGATTTAGTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-1763s1c1
Sequence:CCGGCCTCCCTTTACATGGAAAGATCTCGAGATCTTTCCATGTAAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080737.1-2058s1c1
Sequence:CCGGCCTCACTACAACCATACATTTCTCGAGAAATGTATGGTTGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-1751s21c1
Sequence:GTACCGGGGATTCCTGGAAGCTTGATAACTCGAGTTATCAAGCTTCCAGGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080737.2-2854s21c1
Sequence:GTACCGGTCTTTCTCCTCTCCAATTTATCTCGAGATAAATTGGAGAGGAGAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080737.2-2797s21c1
Sequence:GTACCGGGAAGCAGGGTTGGTTAGTAAACTCGAGTTTACTAACCAACCCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-1110s21c1
Sequence:GTACCGGGATGAGGGTGAGATGATATTTCTCGAGAAATATCATCTCACCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080737.2-2749s21c1
Sequence:GTACCGGCCCTGGCTACCTTTCGCATTACTCGAGTAATGCGAAAGGTAGCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-886s21c1
Sequence:GTACCGGAGGAGCCCAGTGTGCTATTTGCTCGAGCAAATAGCACACTGGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-466s21c1
Sequence:GTACCGGGGCGACTAAAGAATGAGTTACCTCGAGGTAACTCATTCTTTAGTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080737.2-742s21c1
Sequence:GTACCGGACCGCACAGGTAGTGAGATAACTCGAGTTATCTCACTACCTGTGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks