EMAIL THIS PAGE TO A FRIEND

SYTL5

synaptotagmin-like 5

Synonyms: slp5
UniProtKB ID: Q8TDW5, A2RRF2
Gene ID:
Human(94122) Summary: The protein encoded by this gene belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays a role in protein transport. Expression of this gene is restricted to placenta and liver, suggesting that it might be involved in Rab27A-dependent membrane trafficking in specific tissues. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(236643) synaptotagmin-like 5
Rat(302538) synaptotagmin-like 5
Zebrafish(558324) synaptotagmin-like 5
chicken(427990) synaptotagmin-like 5
Horse(100050198) synaptotagmin-like 5
domestic cat(101087131) synaptotagmin-like 5
dog(480877) synaptotagmin-like 5
domestic guinea pig(100720242) synaptotagmin-like 5
naked mole-rat(101708539) synaptotagmin-like 5
Domestic Rabbit(100342153) synaptotagmin-like 5
cow(536666) synaptotagmin-like 5
sheep(101122921) synaptotagmin-like 5
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA026074 Anti-SYTL5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500673 Anti-SYTL5 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138780 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177704 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177704 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177704 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138780 Rosetta Predictions human pricing
NM_178333 Rosetta Predictions rat pricing
NM_177704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029498 predicted 1598
2 SASI_Hs01_00029499 predicted 1607
3 SASI_Hs02_00363903 predicted 1956
4 SASI_Hs02_00363904 predicted 1146
5 SASI_Hs01_00029500 predicted 1235
6 SASI_Hs01_00029501 predicted 884
7 SASI_Hs01_00029503 predicted 1093
8 SASI_Hs01_00029504 predicted 616
9 SASI_Hs01_00029505 predicted 1013
10 SASI_Hs01_00029506 predicted 1562
11 SASI_Hs01_00029502 predicted 641
12 SASI_Hs01_00029507 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032054 predicted 1966
2 SASI_Rn01_00032055 predicted 494
3 SASI_Rn01_00032057 predicted 1011
4 SASI_Rn01_00032058 predicted 886
5 SASI_Rn01_00032059 predicted 621
6 SASI_Rn01_00032060 predicted 1045
7 SASI_Rn01_00032061 predicted 1765
8 SASI_Rn01_00032062 predicted 1188
9 SASI_Rn01_00032063 predicted 970
10 SASI_Rn02_00269641 predicted 1487
11 SASI_Rn01_00032056 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021389 predicted 1128
2 SASI_Mm01_00021390 predicted 1123
3 SASI_Mm01_00021391 predicted 1513
4 SASI_Mm01_00021392 predicted 653
5 SASI_Mm01_00021393 predicted 1253
6 SASI_Mm01_00021394 predicted 1463
7 SASI_Mm01_00021395 predicted 562
8 SASI_Mm01_00021396 predicted 1045
9 SASI_Mm01_00021397 predicted 929
10 SASI_Mm01_00021398 predicted 1016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138780
SYTL5 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin-like 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-1454s21c1
Sequence:GTACCGGAGAGGATACTGTAAGCATAAGCTCGAGCTTATGCTTACAGTATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-1540s21c1
Sequence:GTACCGGCCTTAGTGTCCTCGCAGTTATCTCGAGATAACTGCGAGGACACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-1866s21c1
Sequence:GTACCGGGAAACACTAAAGTACACTATCCTCGAGGATAGTGTACTTTAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-1079s21c1
Sequence:GTACCGGGGACTTAGACGGTCAACATTTCTCGAGAAATGTTGACCGTCTAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-501s21c1
Sequence:GTACCGGATGATCCTGGGCGTCCTAAAGCTCGAGCTTTAGGACGCCCAGGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-853s21c1
Sequence:GTACCGGATGTTGTCCGACAGTCCATTTCTCGAGAAATGGACTGTCGGACAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-379s1c1
Sequence:CCGGCGTTTCAAGCAAGTCAATGTTCTCGAGAACATTGACTTGCTTGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-1688s1c1
Sequence:CCGGCACCAGAACAACTCCAAGGAACTCGAGTTCCTTGGAGTTGTTCTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-1145s1c1
Sequence:CCGGGCCTATCAACTACCAGCCTTACTCGAGTAAGGCTGGTAGTTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-1075s1c1
Sequence:CCGGGAGACTGAAGAAAGCATTGATCTCGAGATCAATGCTTTCTTCAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-1770s1c1
Sequence:CCGGAGTGTTCATCAAAGAGGCAAACTCGAGTTTGCCTCTTTGATGAACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138780
SYTL5 MISSION shRNA shRNA Plasmid DNA
synaptotagmin-like 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-1454s21c1
Sequence:GTACCGGAGAGGATACTGTAAGCATAAGCTCGAGCTTATGCTTACAGTATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-1540s21c1
Sequence:GTACCGGCCTTAGTGTCCTCGCAGTTATCTCGAGATAACTGCGAGGACACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-1866s21c1
Sequence:GTACCGGGAAACACTAAAGTACACTATCCTCGAGGATAGTGTACTTTAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-1079s21c1
Sequence:GTACCGGGGACTTAGACGGTCAACATTTCTCGAGAAATGTTGACCGTCTAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-501s21c1
Sequence:GTACCGGATGATCCTGGGCGTCCTAAAGCTCGAGCTTTAGGACGCCCAGGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-853s21c1
Sequence:GTACCGGATGTTGTCCGACAGTCCATTTCTCGAGAAATGGACTGTCGGACAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-379s1c1
Sequence:CCGGCGTTTCAAGCAAGTCAATGTTCTCGAGAACATTGACTTGCTTGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-1688s1c1
Sequence:CCGGCACCAGAACAACTCCAAGGAACTCGAGTTCCTTGGAGTTGTTCTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-1145s1c1
Sequence:CCGGGCCTATCAACTACCAGCCTTACTCGAGTAAGGCTGGTAGTTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-1075s1c1
Sequence:CCGGGAGACTGAAGAAAGCATTGATCTCGAGATCAATGCTTTCTTCAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-1770s1c1
Sequence:CCGGAGTGTTCATCAAAGAGGCAAACTCGAGTTTGCCTCTTTGATGAACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138780
SYTL5 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin-like 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-1454s21c1
Sequence:GTACCGGAGAGGATACTGTAAGCATAAGCTCGAGCTTATGCTTACAGTATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-1540s21c1
Sequence:GTACCGGCCTTAGTGTCCTCGCAGTTATCTCGAGATAACTGCGAGGACACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-1866s21c1
Sequence:GTACCGGGAAACACTAAAGTACACTATCCTCGAGGATAGTGTACTTTAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-1079s21c1
Sequence:GTACCGGGGACTTAGACGGTCAACATTTCTCGAGAAATGTTGACCGTCTAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-501s21c1
Sequence:GTACCGGATGATCCTGGGCGTCCTAAAGCTCGAGCTTTAGGACGCCCAGGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138780.2-853s21c1
Sequence:GTACCGGATGTTGTCCGACAGTCCATTTCTCGAGAAATGGACTGTCGGACAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-379s1c1
Sequence:CCGGCGTTTCAAGCAAGTCAATGTTCTCGAGAACATTGACTTGCTTGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-1688s1c1
Sequence:CCGGCACCAGAACAACTCCAAGGAACTCGAGTTCCTTGGAGTTGTTCTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-1145s1c1
Sequence:CCGGGCCTATCAACTACCAGCCTTACTCGAGTAAGGCTGGTAGTTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-1075s1c1
Sequence:CCGGGAGACTGAAGAAAGCATTGATCTCGAGATCAATGCTTTCTTCAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138780.x-1770s1c1
Sequence:CCGGAGTGTTCATCAAAGAGGCAAACTCGAGTTTGCCTCTTTGATGAACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177704
SYTL5 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin-like 5
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177704.2-2128s21c1
Sequence:CCGGCTAGGAGGTGTTCGTTTAAATCTCGAGATTTAAACGAACACCTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-671s1c1
Sequence:CCGGGCTTGGACTTAGACAGTCAAACTCGAGTTTGACTGTCTAAGTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-1714s1c1
Sequence:CCGGGCTCCTGATATTAGCCTTCAACTCGAGTTGAAGGCTAATATCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-481s1c1
Sequence:CCGGCCAGGGTCTGAAGAAACACAACTCGAGTTGTGTTTCTTCAGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-520s1c1
Sequence:CCGGCAATGTGTAGACAAGTCAGATCTCGAGATCTGACTTGTCTACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-2048s1c1
Sequence:CCGGGCCTGTATCCTCAGGATATAACTCGAGTTATATCCTGAGGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177704
SYTL5 MISSION shRNA shRNA Plasmid DNA
synaptotagmin-like 5
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177704.2-2128s21c1
Sequence:CCGGCTAGGAGGTGTTCGTTTAAATCTCGAGATTTAAACGAACACCTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-671s1c1
Sequence:CCGGGCTTGGACTTAGACAGTCAAACTCGAGTTTGACTGTCTAAGTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-1714s1c1
Sequence:CCGGGCTCCTGATATTAGCCTTCAACTCGAGTTGAAGGCTAATATCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-481s1c1
Sequence:CCGGCCAGGGTCTGAAGAAACACAACTCGAGTTGTGTTTCTTCAGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-520s1c1
Sequence:CCGGCAATGTGTAGACAAGTCAGATCTCGAGATCTGACTTGTCTACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-2048s1c1
Sequence:CCGGGCCTGTATCCTCAGGATATAACTCGAGTTATATCCTGAGGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177704
SYTL5 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin-like 5
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177704.2-2128s21c1
Sequence:CCGGCTAGGAGGTGTTCGTTTAAATCTCGAGATTTAAACGAACACCTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-671s1c1
Sequence:CCGGGCTTGGACTTAGACAGTCAAACTCGAGTTTGACTGTCTAAGTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-1714s1c1
Sequence:CCGGGCTCCTGATATTAGCCTTCAACTCGAGTTGAAGGCTAATATCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-481s1c1
Sequence:CCGGCCAGGGTCTGAAGAAACACAACTCGAGTTGTGTTTCTTCAGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-520s1c1
Sequence:CCGGCAATGTGTAGACAAGTCAGATCTCGAGATCTGACTTGTCTACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177704.2-2048s1c1
Sequence:CCGGGCCTGTATCCTCAGGATATAACTCGAGTTATATCCTGAGGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks